[Bio] / FigKernelPackages / SSU_rRNA_reps.pm Repository:
ViewVC logotype

View of /FigKernelPackages/SSU_rRNA_reps.pm

Parent Directory Parent Directory | Revision Log Revision Log

Revision 1.1 - (download) (as text) (annotate)
Thu Feb 5 14:50:43 2009 UTC (11 years, 3 months ago) by overbeek
Branch: MAIN
CVS Tags: rast_rel_2009_05_18, rast_rel_2009_0925, rast_rel_2009_07_09, rast_rel_2009_03_26
fixes to support search for rRNAs

package SSU_rRNA_reps;
use strict;
use gjoseqlib;

our @SSU_rRNA_reps = read_fasta( \*DATA );

>E.coli Escherichia coli K12 [gi|49175990 223771-225312]
>Pseu.aerug Pseudomonas aeruginosa PAO1 [gi|15595198 722096-723631]
>Xyle.fasti Xylella fastidiosa Dixon [fig|155919.1.rna.046]
>Nitr.ocean Nitrosococcus oceani ATCC 19707 [fig|323261.3.rna.51]
>Fran.talar Francisella tularensis subsp. tularensis Schu 4 [gi|56707187 c1379589-1378063]
>Thsp.cruno Thiomicrospira crunogena XCL-2 [fig|317025.3.rna.52]
>Nies.menin Neisseria meningitidis MC58 [gi|15675948 60971-62514]
>Rals.solan Ralstonia solanacearum GMI1000 [gi|17544719 1532698-1534234]
>Agro.tumef Agrobacterium tumefaciens str. C58 [fig|176299.3.rna.63]
>Rhod.rubru Rhodospirillum rubrum [fig|1085.1.rna.053]
>Sili.pomer Silicibacter pomeroyi DSS-3 [fig|246200.3.rna.62]
>Magn.MC-1 Magnetococcus sp. MC-1 [fig|156889.1.rna.046]
>Gluc.oxyda Gluconobacter oxydans 621H [fig|290633.1.rna.44]
>C.Pela.ubi Candidatus Pelagibacter ubique HTCC1062 [gi|71082709 511358-512832]
>Rick.prowa Rickettsia prowazekii str. Madrid E [fig|272947.1.rna.25]
>Ehrl.canis Ehrlichia canis str. Jake [fig|269484.4.rna.37]
>Desu.desul Desulfovibrio desulfuricans G20 [fig|207559.3.rna.70]
>Desu.psych Desulfotalea psychrophila LSv54 [gi|51243852 806222-807712]
>Pelo.carbi Pelobacter carbinolicus DSM 2380 [gi|77917618 c2748366-2746944]
>Bact.marin Bacteriovorax marinus SJ [fig|97084.1.rna.14]
>Anae.dehal Anaeromyxobacter dehalogenans 2CP-C [gi|86156430 1361311-1362870]
>Woli.succi Wolinella succinogenes DSM 1740 [gi|34556458 136184-137682]
>Prop.acnes Propionibacterium acnes [fig|267747.1.rna.10 NC_006085_606156_607682]
>Mycb.tuber Mycobacterium tuberculosis CDC1551 [gi|50953765 1471388-1472923]
>Stre.coeli Streptomyces coelicolor A3(2) [fig|100226.1.rna.3]
>Bifi.longu Bifidobacterium longum NCC2705 [fig|206672.1.rna.53]
>Rubr.xylan Rubrobacter xylanophilus DSM 9941 [fig|266117.1.rna.047]
>Chla.trach Chlamydia trachomatis D/UW-3/CX [gi|15604717 854124-855677]
>Para.UWE25 Parachlamydia sp. UWE25 [fig|264201.1.rna.39]
>Ther.marit Thermotoga maritima MSB8 [fig|243274.1.rna.2]
>Fuso.nucle Fusobacterium nucleatum subsp. nucleatum ATCC 25586 [fig|190304.1]
>Aqui.aeoli Aquifex aeolicus VF5 [gi|15282445 c572785-571199]
>Porp.gingi Porphyromonas gingivalis W83 [gi|34539880 119556-121030]
>Bact.frag Bacteroides fragilis YCH46 [gi|53711291 c3145859-3144323]
>Cyto.hutch Cytophaga hutchinsonii [fig|985.1]
>Croc.atlan Croceibacter atlanticus HTCC2559 [fig|216432.3.rna.32]
>Chlo.tepid Chlorobium tepidum TLS [fig|194439.1.rna.54]
>Sali.ruber Salinibacter ruber DSM 13855 [gi|83814055 c3330049-3328508]
>Dein.radio Deinococcus radiodurans R1 [gi|15805042 84836-86337]
>Ther.ther Thermus thermophilus HB8 [gi|55771382 131300-132821]
>Synec.6803 Synechocystis sp. PCC 6803 [fig|1148.1]
>Marc.polym_c Marchantia polymorpha chloroplast [fig|3197.1.rna.44]
>Toxo.gondi_p Toxoplasma gondii plastid [fig|5811.1.rna.36]
>Cyan.calda_c Cyanidium caldarium cyanelle [fig|2771.1.rna.10]
>Cyan.merol_c Cyanidioschyzon merolae chloroplast [fig|45157.1.rna.34]
>Eugl.graci_c Euglena gracilis chloroplast [fig|3039.1.rna.49]
>Borr.burg Borrelia burgdorferi B31 [gi|15594346 c446118-444581]
>Trep.dent Treponema denticola ATCC 35405 [gi|42516522 610184-611729]
>Lept.inter Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130 [fig|267671.1.rna.20]
>Amin.colom Aminobacterium colombiense [TTCGGCTTAGA,gi|4079807]
>Anae.mobil Anaerobaculum mobile [gi|14494874, trimmed]
>Ther.tengc Thermoanaerobacter tengcongensis MB4 [fig|273068.3]
>Ther.xylan Thermoanaerobacterium xylanolyticum [ATRAACATGAGA,gi|349572]
>Deha.ethen Dehalococcoides ethenogenes 195 [gi|57233530 c929873-928439]
>Baci.subti Bacillus subtilis subsp. subtilis str. 168 [fig|224308.1]
>Mycp.hyopn Mycoplasma hyopneumoniae 7448 [fig|262722.3.rna.33]
>Myco.capr Mycoplasma capricolum subsp. capricolum ATCC 27343 [gi|83319253 464430-465954]
>Myco.pneum Mycoplasma pneumoniae M129 [gi|13507739 118312-119824]
>Mycp.penet Mycoplasma penetrans HF-2 [fig|272633.1.rna.32]
>Urea.parvu Ureaplasma parvum serovar 3 ATCC 700970 [fig|273119.1.rna.8]
>Onio.yello Onion yellows phytoplasma OY-M [fig|262768.1.rna.9]
>Clos.perfi Clostridium perfringens str. 13 [fig|195102.1.rna.107]
>Clos.diffi Clostridium difficile 630 [fig|1496.1.rna.81]
>Clos.papyr Clostridium papyrosolvens [TTWTTGAGAG,gi|431242]
>Clos.therm Clostridium thermocellum ATCC 27405 [fig|203119.1.rna.057]
>Clos.cellu Clostridium cellulolyticum [TTGAGAGTTTGATCCTGGCTCAGGACGAACGCTGG,gi|431235]
>Clos.polys Clostridium polysaccharolyticum [TTTTTGAGAG,gi|431244]
>Lact.acido Lactobacillus acidophilus NCFM [fig|272621.3.rna.74]
>Lact.seqri Lactobacillus saerimneri [CCGAATTCGTCGACAACAGAGT,gi|3599569]
>Oeno.oeni Oenococcus oeni PSU-1 [fig|203123.1.rna.043]
>Stre.py.MG Streptococcus pyogenes MGAS5005 [fig|293653.3.rna.85]
>Desu.7475 Desulfotomaculum thermobenzoicum DSM 7475 [gi|2578020]
>Desu.reduc Desulfotomaculum reducens [gi|134050581:10041-11659]
>Hala.chiti Halanaerobacter chitinivorans [CAATCGGAGAGTTTGATCCTGGCCTAGGA,gi|1235890]
>Pelo.therm Pelotomaculum thermopropionicum [gi|146272432:265365-266967]
>Desu.kuznA Desulfotomaculum kuznetsovii (rrnA) [gi|14585793]
>Desu.kuznB Desulfotomaculum kuznetsovii (rrnB) [gi|14585794]
>Moor.ther Moorella thermoacetica ATCC 39073 [gi|83588874 147988-149555]
>Desu.hafni Desulfitobacterium hafniense [fig|49338.1.rna.044]
>Rhod.balti Rhodopirellula baltica SH 1 [gi|32470666 c5078478-5076964]
>Meth.kandl Methanopyrus kandleri AV19 [fig|190192.1.rna.15]
>Meth.janna Methanocaldococcus jannaschii DSM 2661 [fig|243232.1.rna.24]
>Meth.therm Methanothermobacter thermautotrophicus str. Delta H [fig|187420.1.rna.37]
>Meth.aceti Methanosarcina acetivorans C2A [fig|188937.1.rna.10]
>Arch.fulgi Archaeoglobus fulgidus DSM 4304 [fig|224325.1]
>Ther.volca Thermoplasma volcanium GSS1 [fig|273116.1.rna.47]
>Halo.NRC-1 Halobacterium sp. NRC-1 [fig|64091.1.rna.42]
>Pyro.horik Pyrococcus horikoshii OT3 [fig|70601.1.rna.4]
>Sulf.solfa Sulfolobus solfataricus P2 [fig|273057.1.rna.44]
>Aero.perni Aeropyrum pernix K1 (intron removed) [fig|272557.1]
>Pyro.aerop Pyrobaculum aerophilum str. IM2 (intron removed) [fig|178306.1]
>Nano.equit Nanoarchaeum equitans Kin4-M [fig|228908.1]

MCS Webmaster
ViewVC Help
Powered by ViewVC 1.0.3