[Bio] / FigKernelPackages / AdaboostClassifierAMRv1.pm Repository:
ViewVC logotype

Annotation of /FigKernelPackages/AdaboostClassifierAMRv1.pm

Parent Directory Parent Directory | Revision Log Revision Log


Revision 1.1 - (view) (download) (as text)

1 : olson 1.1 #
2 :     # AdaboostValues
3 :     #
4 :    
5 :     # This is a SAS Component
6 :    
7 :     package AdaboostClassifierAMRv1;
8 :     use strict;
9 :     use Data::Dumper;
10 :    
11 :     our %AdaboostValues;
12 :    
13 :     #Hash is returned in the form:
14 :    
15 :     #'Genus species' -> classifier_name -> 'ANTIBIOTICS'
16 :     # -> 'ABBREVIATION' (antibiotic abbrev if appropriate)
17 :     # -> 'ADABOOST' -> Round of boosting -> Alpha Value
18 :     # -> Array of k-mers
19 :     # -> 'RESISTANT' -> 'String of resistant genome ids used to build the classifier'
20 :     # -> 'SUSCEPTIBLE' -> 'String of resistant genome ids used to build the classifier'
21 :     # -> 'AUC' -> 'Area under the ROC curve'
22 :     # -> 'F1' -> 'F1 Score'
23 :     # -> 'ACCURACY' -> 'Accuracy'
24 :     # -> 'COMMENTS' -> 'Some comments about the classifier'
25 :     # -> 'SOURCES' -> 'Major data sources'
26 :     # -> 'FUNCTION' -> 'Function string'
27 :    
28 :    
29 :    
30 :    
31 :     sub Load_Adaboost
32 :     {
33 :     my $alph = shift @_;
34 :     my @alphas = split ("\n", $alph);
35 :     my $count = 0;
36 :     my %hash;
37 :     foreach (@alphas)
38 :     {
39 :     my @array = split /\t/;
40 :     my $alph = shift @array;
41 :     $hash{$count}{ALPHA} = $alph;
42 :     $hash{$count}{KMERS} = \@array;
43 :     $count ++;
44 :     }
45 :     return %hash;
46 :     }
47 :    
48 :    
49 :     #-------------------------------------------------------------
50 :     # Acinetobacter baumannii
51 :     #-------------------------------------------------------------
52 :    
53 :     # Carbapenem
54 :    
55 :     $AdaboostValues{'Acinetobacter baumannii'}{carbapenem}{ANTIBIOTICS} = 'carbapenems';
56 :    
57 :     my $AB_CBPN = <<"End_of_AB_CBPN";
58 :     1.20895 ATAGTTCTGAGGTTGTTGTTCATTATCAAAA
59 :     0.823772 AACTATTTCCTGATTTGTTTTACCTGAGTTG TATCAACTCAGGTAAAACAAATCAGGAAATA ACTATTTCCTGATTTGTTTTACCTGAGTTGA ATCAACTCAGGTAAAACAAATCAGGAAATAG
60 :     0.768177 GTTTATCACCGCGGTTCACACATGGAAGGCA GCCTTCCATGTGTGAACCGCGGTGATAAACA GTGCCTTCCATGTGTGAACCGCGGTGATAAA
61 :     0.580063 ACCGGATGTCTGTAGCAACTCGTGCACTAGC CTAGTGCACGAGTTGCTACAGACATCCGGTC AATCTATGGACCGGATGTCTGTAGCAACTCG AAATCTATGGACCGGATGTCTGTAGCAACTC ATGGACCGGATGTCTGTAGCAACTCGTGCAC TATGGACCGGATGTCTGTAGCAACTCGTGCA ACGAGTTGCTACAGACATCCGGTCCATAGAT CTATGGACCGGATGTCTGTAGCAACTCGTGC GGACCGGATGTCTGTAGCAACTCGTGCACTA AGTGCACGAGTTGCTACAGACATCCGGTCCA CACGAGTTGCTACAGACATCCGGTCCATAGA
62 :     0.62857 GTACTTTATTTACCTATTTTAGTAATAAAGA AAGGTACTTTATTTACCTATTTTAGTAATAA CAGAAGGTACTTTATTTACCTATTTTAGTAA GCAGAAGGTACTTTATTTACCTATTTTAGTA AGAAGGTACTTTATTTACCTATTTTAGTAAT GAAGGTACTTTATTTACCTATTTTAGTAATA CTTTATTACTAAAATAGGTAAATAAAGTACC AGGTACTTTATTTACCTATTTTAGTAATAAA
63 :     0.705269 AGTTAAAACAAATCCAAAAGTAACGATAGCA CAGTGATGTTGATGAACCAGCATAGTGCAGA CTATCGTTACTTTTGGATTTGTTTTAACTGA CCAATTGCAGTGATGTTGATGAACCAGCATA AAATTAACGTCAGTTAAAACAAATCCAAAAG CAATTGCAGTGATGTTGATGAACCAGCATAG TGGAGTATTTGGATCAATTTTTATAGTTACA TGGATCAATTTTTATAGTTACATTTTTTAAA CATCAACATCACTGCAATTGGAGTATTTGGA ATTGGAGTATTTGGATCAATTTTTATAGTTA ACGATAGCAACCACGTTTGCATGCAGTGACA GTTTTAACTGACGTTAATTTAAAAAATGTAA TAAAAAATGTAACTATAAAAATTGATCCAAA AACAAATCCAAAAGTAACGATAGCAACCACG CAATCAATCATGTCACTGCATGCAAACGTGG AACGTCAGTTAAAACAAATCCAAAAGTAACG ATCCAAAAGTAACGATAGCAACCACGTTTGC AATCAATCATGTCACTGCATGCAAACGTGGT CGTTTGCATGCAGTGACATGATTGATTGAAC TATAAAAATTGATCCAAATACTCCAATTGCA ATGTAACTATAAAAATTGATCCAAATACTCC AAAAAATGTAACTATAAAAATTGATCCAAAT CAAATACTCCAATTGCAGTGATGTTGATGAA ATCGTTACTTTTGGATTTGTTTTAACTGACG AAATGTAACTATAAAAATTGATCCAAATACT ACGTTTGCATGCAGTGACATGATTGATTGAA CACGTTTGCATGCAGTGACATGATTGATTGA CAATTTTTATAGTTACATTTTTTAAATTAAC AATCCAAAAGTAACGATAGCAACCACGTTTG CAACATCACTGCAATTGGAGTATTTGGATCA ACAAATCCAAAAGTAACGATAGCAACCACGT AGTGATGTTGATGAACCAGCATAGTGCAGAT TACATTTTTTAAATTAACGTCAGTTAAAACA TGACGTTAATTTAAAAAATGTAACTATAAAA ATAGTTACATTTTTTAAATTAACGTCAGTTA ATTTGTTTTAACTGACGTTAATTTAAAAAAT AATTGATCCAAATACTCCAATTGCAGTGATG ACATTTTTTAAATTAACGTCAGTTAAAACAA GTGACATGATTGATTGAACTTCTGTAGTTGA ATCAACATCACTGCAATTGGAGTATTTGGAT GTTACTTTTGGATTTGTTTTAACTGACGTTA AATTTAAAAAATGTAACTATAAAAATTGATC ATGCTGGTTCATCAACATCACTGCAATTGGA ATTGCAGTGATGTTGATGAACCAGCATAGTG CAATCATGTCACTGCATGCAAACGTGGTTGC CTGCACTATGCTGGTTCATCAACATCACTGC AAAAATTGATCCAAATACTCCAATTGCAGTG ATACTCCAATTGCAGTGATGTTGATGAACCA CTCCAATTGCAGTGATGTTGATGAACCAGCA GATCCAAATACTCCAATTGCAGTGATGTTGA AATCATGTCACTGCATGCAAACGTGGTTGCT AATACTCCAATTGCAGTGATGTTGATGAACC GCACTATGCTGGTTCATCAACATCACTGCAA TAAATTAACGTCAGTTAAAACAAATCCAAAA ACTCCAATTGCAGTGATGTTGATGAACCAGC AACTATAAAAATTGATCCAAATACTCCAATT CTGACGTTAATTTAAAAAATGTAACTATAAA ACTGACGTTAATTTAAAAAATGTAACTATAA AATTTTTATAGTTACATTTTTTAAATTAACG AGAAGTTCAATCAATCATGTCACTGCATGCA AGTGACATGATTGATTGAACTTCTGTAGTTG GTAACTATAAAAATTGATCCAAATACTCCAA AACTACAGAAGTTCAATCAATCATGTCACTG ATGTCACTGCATGCAAACGTGGTTGCTATCG GAAGTTCAATCAATCATGTCACTGCATGCAA AACTGACGTTAATTTAAAAAATGTAACTATA AATTAACGTCAGTTAAAACAAATCCAAAAGT ATTAACGTCAGTTAAAACAAATCCAAAAGTA TTAACGTCAGTTAAAACAAATCCAAAAGTAA CAGTTAAAACAAATCCAAAAGTAACGATAGC AAAATTGATCCAAATACTCCAATTGCAGTGA AAATTGATCCAAATACTCCAATTGCAGTGAT ACATCACTGCAATTGGAGTATTTGGATCAAT CTATAAAAATTGATCCAAATACTCCAATTGC AACATCACTGCAATTGGAGTATTTGGATCAA AATGTAACTATAAAAATTGATCCAAATACTC ACGTTAATTTAAAAAATGTAACTATAAAAAT TTAAAAAATGTAACTATAAAAATTGATCCAA ATTTAAAAAATGTAACTATAAAAATTGATCC TCAATTTTTATAGTTACATTTTTTAAATTAA AAAACAAATCCAAAAGTAACGATAGCAACCA AAACAAATCCAAAAGTAACGATAGCAACCAC GTTGCTATCGTTACTTTTGGATTTGTTTTAA ACTGCATGCAAACGTGGTTGCTATCGTTACT ATGCAGTGACATGATTGATTGAACTTCTGTA CACTGCATGCAAACGTGGTTGCTATCGTTAC CATGTCACTGCATGCAAACGTGGTTGCTATC AAAAGTAACGATAGCAACCACGTTTGCATGC AAACGTGGTTGCTATCGTTACTTTTGGATTT CAAAAGTAACGATAGCAACCACGTTTGCATG CAACCACGTTTGCATGCAGTGACATGATTGA CGTCAACTACAGAAGTTCAATCAATCATGTC TCCAAAAGTAACGATAGCAACCACGTTTGCA AAGTTCAATCAATCATGTCACTGCATGCAAA ACTACAGAAGTTCAATCAATCATGTCACTGC CTACAGAAGTTCAATCAATCATGTCACTGCA ACAGAAGTTCAATCAATCATGTCACTGCATG CATCTGCACTATGCTGGTTCATCAACATCAC TGCACTATGCTGGTTCATCAACATCACTGCA TAACGATAGCAACCACGTTTGCATGCAGTGA GACGTTAATTTAAAAAATGTAACTATAAAAA CATTTTTTAAATTAACGTCAGTTAAAACAAA AAAATGTAACTATAAAAATTGATCCAAATAC AACGATAGCAACCACGTTTGCATGCAGTGAC TCATCTGCACTATGCTGGTTCATCAACATCA AAATACTCCAATTGCAGTGATGTTGATGAAC AGTTCAATCAATCATGTCACTGCATGCAAAC ATAGCAACCACGTTTGCATGCAGTGACATGA GTCAACTACAGAAGTTCAATCAATCATGTCA AACGTGGTTGCTATCGTTACTTTTGGATTTG AAGTAACGATAGCAACCACGTTTGCATGCAG ATAAAAATTGATCCAAATACTCCAATTGCAG AAAGTAACGATAGCAACCACGTTTGCATGCA CCAAATACTCCAATTGCAGTGATGTTGATGA GGTTGCTATCGTTACTTTTGGATTTGTTTTA ACGTCAGTTAAAACAAATCCAAAAGTAACGA AACCACGTTTGCATGCAGTGACATGATTGAT CAGAAGTTCAATCAATCATGTCACTGCATGC AAAAATGTAACTATAAAAATTGATCCAAATA AATTGCAGTGATGTTGATGAACCAGCATAGT AGTTACATTTTTTAAATTAACGTCAGTTAAA ACTATAAAAATTGATCCAAATACTCCAATTG ACATGATTGATTGAACTTCTGTAGTTGACGC ATGCAAACGTGGTTGCTATCGTTACTTTTGG ACTGCAATTGGAGTATTTGGATCAATTTTTA GTTAAAACAAATCCAAAAGTAACGATAGCAA ATCATGTCACTGCATGCAAACGTGGTTGCTA TAGTTACATTTTTTAAATTAACGTCAGTTAA ATCAATTTTTATAGTTACATTTTTTAAATTA GTCAGTTAAAACAAATCCAAAAGTAACGATA CTGGTTCATCAACATCACTGCAATTGGAGTA GTTACATTTTTTAAATTAACGTCAGTTAAAA
64 :     0.453209 ATTCCTTCAAAAGCTTTTAATGCTTTTTCGG CAGCCGAAAAAGCATTAAAAGCTTTTGAAGG CTTCAAAAGCTTTTAATGCTTTTTCGGCTGC GCCGAAAAAGCATTAAAAGCTTTTGAAGGAA AGCCGAAAAAGCATTAAAAGCTTTTGAAGGA AGCAGCCGAAAAAGCATTAAAAGCTTTTGAA
65 :     0.450656 ACTTGTTCCATTTTAGAGATTTGTTTAAGAT CTTAAACAAATCTCTAAAATGGAACAAGTCA CTTGTTCCATTTTAGAGATTTGTTTAAGATA TTATCTTAAACAAATCTCTAAAATGGAACAA GACTTGTTCCATTTTAGAGATTTGTTTAAGA
66 :     0.55898 AGTTTTTAGTCAGAAATGGCTATATCGATGC CATCGATATAGCCATTTCTGACTAAAAACTC
67 :     0.502075 CTGTGCTTTCGAATTATTTTCGACACGTAAA TGTGCTTTCGAATTATTTTCGACACGTAAAA TCTGTGCTTTCGAATTATTTTCGACACGTAA GGTTTTACGTGTCGAAAATAATTCGAAAGCA GTGCTTTCGAATTATTTTCGACACGTAAAAC GTCTGTGCTTTCGAATTATTTTCGACACGTA ACGTGTCGAAAATAATTCGAAAGCACAGACA
68 :     End_of_AB_CBPN
69 :    
70 :     my %load = &Load_Adaboost ($AB_CBPN);
71 :     $AdaboostValues{'Acinetobacter baumannii'}{carbapenem}{ADABOOST} = \%load;
72 :     $AdaboostValues{'Acinetobacter baumannii'}{carbapenem}{RESISTANT} = '1310620.3 1310650.3 1310767.3 1310739.3 1310718.3 1310625.3 1310564.3 1310725.3 1310760.3 1310567.3 1310792.3 1310713.3 1310708.3 1310555.3 1310738.3 1310578.3 1310757.3 1310668.3 1310716.3 1310721.3 1310737.3 1310808.3 1310768.3 1310610.3 1310747.3 1310617.3 1310811.3 1310663.3 1310676.3 1310798.3 1310775.3 1310809.3 1310666.3 1310584.3 1310570.3 1310579.3 1310774.3 1310749.3 1310602.3 1310624.3 1310744.3 1310753.3 1310717.3 1310771.3 1310649.3 1310729.3 1310780.3 1310631.3 1310633.3 1310732.3 1310554.3 1310675.3 1310755.3 1310586.3 1310575.3 1310585.3 1310805.3 1310571.3 1310796.3 1310727.3 1310754.3 1310799.3 1310557.3 1310720.3 1310568.3 1310743.3 1310588.3 1310595.3 1310813.3 1310559.3 1310735.3 1310826.3 1310580.3 1310569.3 1310616.3 1310600.3 1310614.3 1310591.3 1310815.3 1310742.3 1310730.3 1310740.3 1310686.3 1310644.3 1310745.3 1310653.3 1310561.3 1310587.3 1310699.3 1310627.3 1310765.3 1310806.3 1310783.3 1310673.3 1310825.3 1310763.3 1310782.3 1310592.3 1310691.3 1310558.3 1310596.3 1310646.3 1310556.3 1310656.3 1310746.3 1310597.3 1310629.3 1310572.3 1310741.3 1310698.3';
73 :     $AdaboostValues{'Acinetobacter baumannii'}{carbapenem}{SUSCEPTIBLE} = '1310788.3 1310787.3 1310674.3 1310818.3 1310638.3 1310801.3 1310759.3 1310736.3 1310812.3 1310618.3 1310688.3 1310622.6 1310677.3 1310706.3 1310750.3 1310654.3 1310773.3 1310623.3 1310795.3 1310694.3 1310679.3 1310802.3 1310770.3 1310685.3 1310710.3 1310781.3 1310661.3 1310669.3 1310681.3 1310824.3 1310764.3 1310756.3 1310722.3 1310626.3 1310621.3 1310601.3 1310628.3 1310651.3 1310705.3 1310608.3 1310761.3 1310711.3 1310719.3 1310728.3 1310772.3 1310793.3 1310607.3 1310689.3 1310702.3 1310786.3 1310734.3 1310563.3 1310703.3 1310647.3 1310683.3 1310643.3 1310748.3 1310655.3 1310790.3 1310789.3 1310609.3 1310672.3 1310603.3 1310762.3 1310662.3 1310611.3 1310605.3 1310630.3 1310652.3 1310613.3 1310701.3 1310791.3 1310590.3 1310779.3 1310659.3 1310641.3 1310606.3 1310583.3 1310807.3 1310637.3 1310680.3 1310642.3 1310640.3 1310599.3 1310657.3 1310697.3 1310645.3 1310797.3 1310778.3 1310660.3 1310619.3 1310752.3 1310670.3 1310700.3 1310724.3 1310684.3 1310636.3 1310695.3 1310581.3 1310615.3 1310692.3 1310707.3 1310723.3 1310820.3 1310816.3 1310604.3 1310639.3 1310665.3 1310634.3 1310784.3';
74 :     $AdaboostValues{'Acinetobacter baumannii'}{carbapenem}{AUC} = '0.964';
75 :     $AdaboostValues{'Acinetobacter baumannii'}{carbapenem}{F1} = '0.950';
76 :     $AdaboostValues{'Acinetobacter baumannii'}{carbapenem}{ACCURACY} = '0.945';
77 :     $AdaboostValues{'Acinetobacter baumannii'}{carbapenem}{SOURCES} = 'Genome Sequencing Center for Infectious Diseases (GSCID), University of Maryland School of Medicine';
78 :     $AdaboostValues{'Acinetobacter baumannii'}{carbapenem}{FUNCTION} = 'Carbapenem resistance predicted region';
79 :    
80 :     #-------------------------------------------------------------
81 :    
82 :    
83 :    
84 :    
85 :     #-------------------------------------------------------------
86 :     # Staphyloccus aureus
87 :     #-------------------------------------------------------------
88 :    
89 :     # Methicillin
90 :    
91 :     $AdaboostValues{'Staphylococcus aureus'}{methicillin}{ANTIBIOTICS} = 'methicillin';
92 :     $AdaboostValues{'Staphylococcus aureus'}{methicillin}{ABBREVIATIONS} = 'DP';
93 :     my $SA_DP = <<"End_of_SA_DP";
94 :     2.3681 TTAACAGCAATGATTGGGTTAAATAACAAAA TATTAATAAGTGCTGTTACTTCTCCCTTAAA TATTAACAGCAATGATTGGGTTAAATAACAA TAACCCAATCATTGCTGTTAATATTTTTTGA TAACAGCACTTATTAATAATTCATAATAAAA GTATTTAAGGGAGAAGTAACAGCACTTATTA GGGAGAAGTAACAGCACTTATTAATAATTCA GGAACAGCATATGAGATAGGCATCGTTCCAA GCCTATCTCATATGCTGTTCCTGTATTGGCC GCCAATACAGGAACAGCATATGAGATAGGCA GAATTGGCCAATACAGGAACAGCATATGAGA GAACAGCATATGAGATAGGCATCGTTCCAAA GAAATTGTATTTAAGGGAGAAGTAACAGCAC CTATCTCATATGCTGTTCCTGTATTGGCCAA CCTATCTCATATGCTGTTCCTGTATTGGCCA CCAGGTTCAACTCAAAAAATATTAACAGCAA CATATGCTGTTCCTGTATTGGCCAATTCCAC CAGGAACAGCATATGAGATAGGCATCGTTCC CAATGTGGAATTGGCCAATACAGGAACAGCA CAATCATTGCTGTTAATATTTTTTGAGTTGA CAAAAAATATTAACAGCAATGATTGGGTTAA ATTGTATTTAAGGGAGAAGTAACAGCACTTA ATTGGCCAATACAGGAACAGCATATGAGATA ATTGCTGTTAATATTTTTTGAGTTGAACCTG ATTATTAATAAGTGCTGTTACTTCTCCCTTA ATTATGAATTATTAATAAGTGCTGTTACTTC ATTAACAGCAATGATTGGGTTAAATAACAAA ATGTGGAATTGGCCAATACAGGAACAGCATA ATGCCTATCTCATATGCTGTTCCTGTATTGG ATGAATTATTAATAAGTGCTGTTACTTCTCC ATCATTGCTGTTAATATTTTTTGAGTTGAAC ATATGCTGTTCCTGTATTGGCCAATTCCACA ATAAGTGCTGTTACTTCTCCCTTAAATACAA AGTAACAGCACTTATTAATAATTCATAATAA AGGTTCAACTCAAAAAATATTAACAGCAATG AGGGAGAAGTAACAGCACTTATTAATAATTC AGAAGTAACAGCACTTATTAATAATTCATAA AGAAATTGTATTTAAGGGAGAAGTAACAGCA ACGATGCCTATCTCATATGCTGTTCCTGTAT ACCCAATCATTGCTGTTAATATTTTTTGAGT ACCAGGTTCAACTCAAAAAATATTAACAGCA ACAGGAACAGCATATGAGATAGGCATCGTTC AATTGGCCAATACAGGAACAGCATATGAGAT AATGTGGAATTGGCCAATACAGGAACAGCAT AATCATTGCTGTTAATATTTTTTGAGTTGAA AATATTAACAGCAATGATTGGGTTAAATAAC AATACAGGAACAGCATATGAGATAGGCATCG AAGTAACAGCACTTATTAATAATTCATAATA AAGGGAGAAGTAACAGCACTTATTAATAATT AACTCAAAAAATATTAACAGCAATGATTGGG AACGATGCCTATCTCATATGCTGTTCCTGTA AACCCAATCATTGCTGTTAATATTTTTTGAG AACAGCATATGAGATAGGCATCGTTCCAAAG AACAGCACTTATTAATAATTCATAATAAAAC AAATTGTATTTAAGGGAGAAGTAACAGCACT AAAATATTAACAGCAATGATTGGGTTAAATA AAAAATATTAACAGCAATGATTGGGTTAAAT AAAAAATATTAACAGCAATGATTGGGTTAAA TGGCATGCATACACTTTCAATATCATTTAAA TGATATTGAAAGTGTATGCATGCCAGATGCA TCTTTTACCATTTTTACTTTTGCTTTAGTAA TCTAACTTCCACATACCATCTTCTTTAACAA TCATATAGCTCATCATACACTTTACCTGAGA TATCATTGCATCTGGCATGCATACACTTTCA TACTAAAGCAAAAGTAAAAATGGTAAAAGAA TACACTTTCAATATCATTTAAATTATGGGTA TAATGACGCTATGATCCCAATCTAACTTCCA TAACTTCCACATACCATCTTCTTTAACAAAA TAAATGATATTGAAAGTGTATGCATGCCAGA GCTATGATCCCAATCTAACTTCCACATACCA GCTACAATGCCAAAATCTCAGGTAAAGTGTA GCCAAAATCTCAGGTAAAGTGTATGATGAGC GATGGTATGTGGAAGTTAGATTGGGATCATA GACGCTATGATCCCAATCTAACTTCCACATA GAAAGTGTATGCATGCCAGATGCAATGATAC CTTACTAAAGCAAAAGTAAAAATGGTAAAAG CTCATCATACACTTTACCTGAGATTTTGGCA CTCAGGTAAAGTGTATGATGAGCTATATGAG CTAACTTCCACATACCATCTTCTTTAACAAA CTAAAGCAAAAGTAAAAATGGTAAAAGAAGC CGTTCTCATATAGCTCATCATACACTTTACC CGCTTCTTTTACCATTTTTACTTTTGCTTTA CGCTATGATCCCAATCTAACTTCCACATACC CCGTTCTCATATAGCTCATCATACACTTTAC CCATAATTTAAATGATATTGAAAGTGTATGC CATTGCATCTGGCATGCATACACTTTCAATA CATGCATACACTTTCAATATCATTTAAATTA CATACACTTTACCTGAGATTTTGGCATTGTA CATAATTTAAATGATATTGAAAGTGTATGCA CAGGTAAAGTGTATGATGAGCTATATGAGAA CAATCTAACTTCCACATACCATCTTCTTTAA ATTTAAATGATATTGAAAGTGTATGCATGCC ATTGAAAGTGTATGCATGCCAGATGCAATGA ATGTGGAAGTTAGATTGGGATCATAGCGTCA ATGCCAAAATCTCAGGTAAAGTGTATGATGA ATGATATTGAAAGTGTATGCATGCCAGATGC ATCTAACTTCCACATACCATCTTCTTTAACA ATCATTGCATCTGGCATGCATACACTTTCAA ATATTGAAAGTGTATGCATGCCAGATGCAAT ATACACTTTACCTGAGATTTTGGCATTGTAG AGGTAAAGTGTATGATGAGCTATATGAGAAC AGCTCATCATACACTTTACCTGAGATTTTGG AGATGGTATGTGGAAGTTAGATTGGGATCAT AGAAGATGGTATGTGGAAGTTAGATTGGGAT ACTTACTAAAGCAAAAGTAAAAATGGTAAAA ACTAAAGCAAAAGTAAAAATGGTAAAAGAAG ACGCTATGATCCCAATCTAACTTCCACATAC ACCGTTCTCATATAGCTCATCATACACTTTA AATTTAAATGATATTGAAAGTGTATGCATGC AATGCCAAAATCTCAGGTAAAGTGTATGATG AATGACGCTATGATCCCAATCTAACTTCCAC AATCTCAGGTAAAGTGTATGATGAGCTATAT AATCTAACTTCCACATACCATCTTCTTTAAC AAGTGTATGCATGCCAGATGCAATGATACCT AAGAAGATGGTATGTGGAAGTTAGATTGGGA AACTTCCACATACCATCTTCTTTAACAAAAT AAATGATATTGAAAGTGTATGCATGCCAGAT AAATCTCAGGTAAAGTGTATGATGAGCTATA AAAGTGTATGCATGCCAGATGCAATGATACC AAAGCAAAAGTAAAAATGGTAAAAGAAGCGG AAAGAAGATGGTATGTGGAAGTTAGATTGGG TTCAAAAGAGTATTTATAACAACATGAAAAA TGCAGTTATTGGTAAAAAGGGACTCGAAAAA TGATGCAGTTATTGGTAAAAAGGGACTCGAA TGAGCCATAATCATTTTTCATGTTGTTATAA TCCAAACATGATGATGGCTATTAATGTTAAA TCATATGATAAAGATAATCCAAACATGATGA GTTCAAAAGAGTATTTATAACAACATGAAAA GCTCCAACATGAAGATGGCTATCGTGTCACA GCTATAAAGATGATGCAGTTATTGGTAAAAA GATGCAGTTATTGGTAAAAAGGGACTCGAAA GATAAAGATAATCCAAACATGATGATGGCTA GAATATAAAGGCTATAAAGATGATGCAGTTA CTGAGCCATAATCATTTTTCATGTTGTTATA CTCCAACATGAAGATGGCTATCGTGTCACAA CCTTTTTACCAATAACTGCATCATCTTTATA CCATCATCATGTTTGGATTATCTTTATCATA CCATAATCATTTTTCATGTTGTTATAAATAC CCAAACATGATGATGGCTATTAATGTTAAAG CATCTTCATGTTGGAGCTTTTTATCGTAAAG CAAACATGATGATGGCTATTAATGTTAAAGA CAAAAGAGTATTTATAACAACATGAAAAATG ATTTTTCATGTTGTTATAAATACTCTTTTGA ATTGTGACACGATAGCCATCTTCATGTTGGA ATGATGCAGTTATTGGTAAAAAGGGACTCGA ATGATAAAGATAATCCAAACATGATGATGGC ATCCAAACATGATGATGGCTATTAATGTTAA ATCATGTTTGGATTATCTTTATCATATGATA ATCATCATGTTTGGATTATCTTTATCATATG ATATGATAAAGATAATCCAAACATGATGATG ATATCATATGATAAAGATAATCCAAACATGA ATAGCCATCTTCATGTTGGAGCTTTTTATCG ATAATCATTTTTCATGTTGTTATAAATACTC ATAACAACATGAAAAATGATTATGGCTCAGG ATAAAGATGATGCAGTTATTGGTAAAAAGGG AGTATTTATAACAACATGAAAAATGATTATG AGTACCTGAGCCATAATCATTTTTCATGTTG AGGCTATAAAGATGATGCAGTTATTGGTAAA AGCTCCAACATGAAGATGGCTATCGTGTCAC AGCCATCTTCATGTTGGAGCTTTTTATCGTA AGCCATAATCATTTTTCATGTTGTTATAAAT AGATGATGCAGTTATTGGTAAAAAGGGACTC AGATAATCCAAACATGATGATGGCTATTAAT AGAGTATTTATAACAACATGAAAAATGATTA ACGATAGCCATCTTCATGTTGGAGCTTTTTA ACGATAAAAAGCTCCAACATGAAGATGGCTA ACCTGAGCCATAATCATTTTTCATGTTGTTA ACCAATAACTGCATCATCTTTATAGCCTTTA ACATTAATAGCCATCATCATGTTTGGATTAT ACAACATGAAAAATGATTATGGCTCAGGTAC AATCCAAACATGATGATGGCTATTAATGTTA AATATAAAGGCTATAAAGATGATGCAGTTAT AATAACTGCATCATCTTTATAGCCTTTATAT AAGTTCAAAAGAGTATTTATAACAACATGAA AAGATGATGCAGTTATTGGTAAAAAGGGACT AAGAGTATTTATAACAACATGAAAAATGATT AACTTTACGATAAAAAGCTCCAACATGAAGA AACATGAAGATGGCTATCGTGTCACAATCGT AACATGAAAAATGATTATGGCTCAGGTACTG AACAACATGAAAAATGATTATGGCTCAGGTA AAAGTTCAAAAGAGTATTTATAACAACATGA AAAGGCTATAAAGATGATGCAGTTATTGGTA AAAGCTCCAACATGAAGATGGCTATCGTGTC AAAGATGATGCAGTTATTGGTAAAAAGGGAC AAAGATAATCCAAACATGATGATGGCTATTA AAAGAGTATTTATAACAACATGAAAAATGAT AAACTTTACGATAAAAAGCTCCAACATGAAG AAACATGATGATGGCTATTAATGTTAAAGAT AAAAGCTCCAACATGAAGATGGCTATCGTGT AAAACTTTACGATAAAAAGCTCCAACATGAA TCACCTCTAACTTTCTATTGAGACAAATGCA TAAACTATTATATATTTTTATCGGACGTTCA GAAATGACTGAACGTCCGATAAAAATATATA CTCACCTCTAACTTTCTATTGAGACAAATGC CTAAACTATTATATATTTTTATCGGACGTTC CCTCTAACTTTCTATTGAGACAAATGCACCA CATACAATGAAAATGAAGAAATTGTATTTAA CACCTCTAACTTTCTATTGAGACAAATGCAC CAATGAAAATGAAGAAATTGTATTTAAGGGA ATTTGTCTCAATAGAAAGTTAGAGGTGAGTC ATGGTGCATTTGTCTCAATAGAAAGTTAGAG ATGACTGAACGTCCGATAAAAATATATAATA ACTATTATATATTTTTATCGGACGTTCAGTC ACCTCTAACTTTCTATTGAGACAAATGCACC ACATACAATGAAAATGAAGAAATTGTATTTA ACAATGAAAATGAAGAAATTGTATTTAAGGG AATGGTGCATTTGTCTCAATAGAAAGTTAGA AATGACTGAACGTCCGATAAAAATATATAAT AATAATGACGCTATGATCCCAATCTAACTTC AAGTTAGATTGGGATCATAGCGTCATTATTC AACGTCCGATAAAAATATATAATAGTTTAGG AAATGGTGCATTTGTCTCAATAGAAAGTTAG AAATGACTGAACGTCCGATAAAAATATATAA AAACTATTATATATTTTTATCGGACGTTCAG TGAATCAGCTAATAATATTTCATTATCTAAA CTGAATCAGCTAATAATATTTCATTATCTAA CCTGAATCAGCTAATAATATTTCATTATCTA ATTTAGATAATGAAATATTATTAGCTGATTC AAGGCTATAAAGATGATGCAGTTATTGGTAA AATCAGCTAATAATATTTCATTATCTAAATT TATTAAAAGACACGAAAAACAAAGTTTGGAA TATATAATAGTTTAGGCGTTAAAGATATAAA TAAAAATATATAATAGTTTAGGCGTTAAAGA GTTTAGGCGTTAAAGATATAAACATTCAGGA GCACCTCACTTATTAAAAGACACGAAAAACA GATAAAAATATATAATAGTTTAGGCGTTAAA CTGAATGTTTATATCTTTAACGCCTAAACTA CGATCCTGAATGTTTATATCTTTAACGCCTA CGATAAAAATATATAATAGTTTAGGCGTTAA CCTCACTTATTAAAAGACACGAAAAACAAAG CCGATAAAAATATATAATAGTTTAGGCGTTA CCAAACTTTGTTTTTCGTGTCTTTTAATAAG ATTAAAAGACACGAAAAACAAAGTTTGGAAG ATCCTGAATGTTTATATCTTTAACGCCTAAA ATATATAATAGTTTAGGCGTTAAAGATATAA ATATAATAGTTTAGGCGTTAAAGATATAAAC ATAGTTTAGGCGTTAAAGATATAAACATTCA ATAATAGTTTAGGCGTTAAAGATATAAACAT ATAAAAATATATAATAGTTTAGGCGTTAAAG AGTTTAGGCGTTAAAGATATAAACATTCAGG ACTTTGTTTTTCGTGTCTTTTAATAAGTGAG ACTTATTAAAAGACACGAAAAACAAAGTTTG ACGATCCTGAATGTTTATATCTTTAACGCCT ACCTCACTTATTAAAAGACACGAAAAACAAA AATGTTTATATCTTTAACGCCTAAACTATTA AATATATAATAGTTTAGGCGTTAAAGATATA AAGACACGAAAAACAAAGTTTGGAAGAAAAA AACTTTGTTTTTCGTGTCTTTTAATAAGTGA AACGCCTAAACTATTATATATTTTTATCGGA AAACTTTGTTTTTCGTGTCTTTTAATAAGTG AAAATATATAATAGTTTAGGCGTTAAAGATA AAAAGACACGAAAAACAAAGTTTGGAAGAAA AAAAATATATAATAGTTTAGGCGTTAAAGAT TATGGGTAGAAGAAGGTAAATACGGAGAAGA TAGTTACGACTTTCTGTTTCATTAGTTGTAA TAAATTATGGGTAGAAGAAGGTAAATACGGA GTTACGACTTTCTGTTTCATTAGTTGTAAGA GATGGTATGCAACAAGTCGTAAATAAAACAC CTTCTTCTCCGTATTTACCTTCTTCTACCCA CTTCTCCGTATTTACCTTCTTCTACCCATAA CTGATGGTATGCAACAAGTCGTAAATAAAAC CCGTATTTACCTTCTTCTACCCATAATTTAA CATCTTACAACTAATGAAACAGAAAGTCGTA ATTATGGGTAGAAGAAGGTAAATACGGAGAA ATGGGTAGAAGAAGGTAAATACGGAGAAGAA ACTTCTTCTCCGTATTTACCTTCTTCTACCC ACTGATGGTATGCAACAAGTCGTAAATAAAA AAATTATGGGTAGAAGAAGGTAAATACGGAG ATAAAAATTTCAAACAAGTTTATAAAGATAG GATCCTGAATGTTTATATCTTTAACGCCTAA AACATGATGATGGCTATTAATGTTAAAGATG AAAATTTCAAACAAGTTTATAAAGATAGCAG TGTTAAACTTGCAGAAGAAATCATGCCACAA TGGCAAATGTTCATCTTTGAATTTTTCACCA TCAAAGATGAACATTTGCCAACTTTCGATGA TATTGTGGCATGATTTCTTCTGCAAGTTTAA TAATGTTGTGCTTGTTAAACTTGCAGAAGAA TAAGTGGAACGAAGGTATCATCTTGTACCCA GTTTTAAGTGGAACGAAGGTATCATCTTGTA GTTGTGCTTGTTAAACTTGCAGAAGAAATCA GTTCATCTTTGAATTTTTCACCAAACCAAGA GTGAAAAATTCAAAGATGAACATTTGCCAAC GTACAAGATGATACCTTCGTTCCACTTAAAA GGTGAAAAATTCAAAGATGAACATTTGCCAA GGGTACAAGATGATACCTTCGTTCCACTTAA GGCATGATTTCTTCTGCAAGTTTAACAAGCA GGCAAATGTTCATCTTTGAATTTTTCACCAA GCTTGTTAAACTTGCAGAAGAAATCATGCCA GCAAATGTTCATCTTTGAATTTTTCACCAAA GATTTCTTCTGCAAGTTTAACAAGCACAACA GATGTTGCAATTACAAAAGATGAACAACTGA GATCTTGGTTTGGTGAAAAATTCAAAGATGA GACTTTCTGTTTCATTAGTTGTAAGATGAAA GAAGGTATCATCTTGTACCCAATTTTGATCC CTTGTTAAACTTGCAGAAGAAATCATGCCAC CTTGGTTTGGTGAAAAATTCAAAGATGAACA CTTCTGCAAGTTTAACAAGCACAACATTAAA CTCCCCAATTAGCAAGTTGGTTTGCACGTGC CGACTTTCTGTTTCATTAGTTGTAAGATGAA CGAAGGTATCATCTTGTACCCAATTTTGATC CCAGCACGTGCAAACCAACTTGCTAATTGGG CATGATTTCTTCTGCAAGTTTAACAAGCACA CATCGAAAGTTGGCAAATGTTCATCTTTGAA CAAGCTTTAATGTTGTGCTTGTTAAACTTGC CAAGATGATACCTTCGTTCCACTTAAAACCG CAAATGTTCATCTTTGAATTTTTCACCAAAC CAAAATTGGGTACAAGATGATACCTTCGTTC CAAAAAGAATATAAAGGCTATAAAGATGATG ATGTTGTGCTTGTTAAACTTGCAGAAGAAAT ATGATTTCTTCTGCAAGTTTAACAAGCACAA ATCATCGAAAGTTGGCAAATGTTCATCTTTG AGTTGGCAAATGTTCATCTTTGAATTTTTCA AGTGGAACGAAGGTATCATCTTGTACCCAAT AGGTATCATCTTGTACCCAATTTTGATCCAT AGCTTTAATGTTGTGCTTGTTAAACTTGCAG AGCACGTGCAAACCAACTTGCTAATTGGGGA ACTCCCCAATTAGCAAGTTGGTTTGCACGTG ACGAAGGTATCATCTTGTACCCAATTTTGAT ACCAGCACGTGCAAACCAACTTGCTAATTGG ACAAGATGATACCTTCGTTCCACTTAAAACC ACAAATGGATCAAAATTGGGTACAAGATGAT ACAAAAAGAATATAAAGGCTATAAAGATGAT AATTTCATCTTACAACTAATGAAACAGAAAG AATTGGGTACAAGATGATACCTTCGTTCCAC AATTCAAAGATGAACATTTGCCAACTTTCGA AATGTTGTGCTTGTTAAACTTGCAGAAGAAA AATGTTCATCTTTGAATTTTTCACCAAACCA AATGGATCAAAATTGGGTACAAGATGATACC AAGTTGGCAAATGTTCATCTTTGAATTTTTC AAGCTTTAATGTTGTGCTTGTTAAACTTGCA AAGATGATACCTTCGTTCCACTTAAAACCGT AAGATGAACATTTGCCAACTTTCGATGATGT AAGAATATAAAGGCTATAAAGATGATGCAGT AACTTGCAGAAGAAATCATGCCACAATATAA AACGAAGGTATCATCTTGTACCCAATTTTGA AACAAAAAGAATATAAAGGCTATAAAGATGA AAATTTCATCTTACAACTAATGAAACAGAAA AAATTGGGTACAAGATGATACCTTCGTTCCA AAATTCAAAGATGAACATTTGCCAACTTTCG AAATGTTCATCTTTGAATTTTTCACCAAACC AAATGGATCAAAATTGGGTACAAGATGATAC AAAGAATATAAAGGCTATAAAGATGATGCAG AAACTTGCAGAAGAAATCATGCCACAATATA AAAATTGGGTACAAGATGATACCTTCGTTCC AAAAGAATATAAAGGCTATAAAGATGATGCA AAAAATTTCATCTTACAACTAATGAAACAGA AAAAAGAATATAAAGGCTATAAAGATGATGC AAAAAATTTCATCTTACAACTAATGAAACAG AAAAAAATTTCATCTTACAACTAATGAAACA GTTATAAAATCGATGGTAAAGGTTGGCAAAA CTTTTTGCCAACCTTTACCATCGATTTTATA ACTCACCTCTAACTTTCTATTGAGACAAATG AATCGATGGTAAAGGTTGGCAAAAAGATAAA AAATTTGAGCATTATAAAATGGATAATCACT AAATCGATGGTAAAGGTTGGCAAAAAGATAA AAAATCGATGGTAAAGGTTGGCAAAAAGATA TTAGCTGATTCAGGTTACGGACAAGGTGAAA TCCGTAACCTGAATCAGCTAATAATATTTCA TATTAGCTGATTCAGGTTACGGACAAGGTGA GTAACCTGAATCAGCTAATAATATTTCATTA GCTGATTCAGGTTACGGACAAGGTGAAATAC GATTCAGGTTACGGACAAGGTGAAATACTGA GAAATATTATTAGCTGATTCAGGTTACGGAC CAGTATTTCACCTTGTCCGTAACCTGAATCA ATTTCACCTTGTCCGTAACCTGAATCAGCTA AAATTTCAAACAAGTTTATAAAGATAGCAGT ATGAAATATTATTAGCTGATTCAGGTTACGG ATATTATTAGCTGATTCAGGTTACGGACAAG AGTATTTCACCTTGTCCGTAACCTGAATCAG AGCTGATTCAGGTTACGGACAAGGTGAAATA ATAATGAAATATTATTAGCTGATTCAGGTTA AATGAAATATTATTAGCTGATTCAGGTTACG AATCAGTATTTCACCTTGTCCGTAACCTGAA AATATTATTAGCTGATTCAGGTTACGGACAA AACCTGAATCAGCTAATAATATTTCATTATC AAATATTATTAGCTGATTCAGGTTACGGACA TCTGTTATATTGTGGCATGATTTCTTCTGCA TCAAAACAAAAAGCCTTCATATTACAGAAGA TATTACAGAAGAAGAAATTATCCAATTTGCA TAGGAGAAACATTCAAAACAAAAAGCCTTCA TACAGAAGAAGAAATTATCCAATTTGCAACA GTTGCAAATTGGATAATTTCTTCTTCTGTAA GGAGAAACATTCAAAACAAAAAGCCTTCATA ATATTAACAGCAATGATTGGGTTAAATAACA GAAGGCTTTTTGTTTTGAATGTTTCTCCTAC GAAACATTCAAAACAAAAAGCCTTCATATTA CTTGCAGAAGAAATCATGCCACAATATAACA CTGTTATATTGTGGCATGATTTCTTCTGCAA CATTCAAAACAAAAAGCCTTCATATTACAGA CAGAAGAAGAAATTATCCAATTTGCAACAAC CAAATTGGATAATTTCTTCTTCTGTAATATG CAAAAGTTGTTGCAAATTGGATAATTTCTTC CAAAACAAAAAGCCTTCATATTACAGAAGAA AAAATTTCATCTTACAACTAATGAAACAGAA ATTTCTTCTTCTGTAATATGAAGGCTTTTTG ATTCAAAACAAAAAGCCTTCATATTACAGAA ATTACAGAAGAAGAAATTATCCAATTTGCAA ATATTACAGAAGAAGAAATTATCCAATTTGC ATATGAAGGCTTTTTGTTTTGAATGTTTCTC AGGAGAAACATTCAAAACAAAAAGCCTTCAT AGAAGAAGAAATTATCCAATTTGCAACAACT AGAAATTATCCAATTTGCAACAACTTTTGAT ACTTGCAGAAGAAATCATGCCACAATATAAC ACATTCAAAACAAAAAGCCTTCATATTACAG ACAAAAAGCCTTCATATTACAGAAGAAGAAA AAGCTCCAACATGAAGATGGCTATCGTGTCA AATTATCCAATTTGCAACAACTTTTGATCCT AAGTTGTTGCAAATTGGATAATTTCTTCTTC AAGAAATTATCCAATTTGCAACAACTTTTGA AACAAAAAGCCTTCATATTACAGAAGAAGAA AAATTATCCAATTTGCAACAACTTTTGATCC AAAGTTGTTGCAAATTGGATAATTTCTTCTT AAAGCCTTCATATTACAGAAGAAGAAATTAT AAACATTCAAAACAAAAAGCCTTCATATTAC AAACAAAAAGCCTTCATATTACAGAAGAAGA AAAATTCAAAGATGAACATTTGCCAACTTTC AAAAGCCTTCATATTACAGAAGAAGAAATTA AAAACAAAAAGCCTTCATATTACAGAAGAAG TTACTGCCTAATTCGAGTGCTACTCTAGCAA TACTGCCTAATTCGAGTGCTACTCTAGCAAA GCTTTAATGTTGTGCTTGTTAAACTTGCAGA GCTAGAGTAGCACTCGAATTAGGCAGTAAGA GCCTAATTCGAGTGCTACTCTAGCAAAGAAA GCACTCGAATTAGGCAGTAAGAAATTTGAAA GAATTAGGCAGTAAGAAATTTGAAAAAGGCA CTCGAATTAGGCAGTAAGAAATTTGAAAAAG CGAATTAGGCAGTAAGAAATTTGAAAAAGGC CCTTTTTCAAATTTCTTACTGCCTAATTCGA CCTAATTCGAGTGCTACTCTAGCAAAGAAAA CACTCGAATTAGGCAGTAAGAAATTTGAAAA AGCACTCGAATTAGGCAGTAAGAAATTTGAA AGAGTAGCACTCGAATTAGGCAGTAAGAAAT ACTGCCTAATTCGAGTGCTACTCTAGCAAAG ACTCGAATTAGGCAGTAAGAAATTTGAAAAA GCTATCTTTATAAACTTGTTTGAAATTTTTA AATTTCTTACTGCCTAATTCGAGTGCTACTC TTCAATATCATTTAAATTATGGGTAGAAGAA TTATTAATTTCTTTATCTTTTGAAGCATAAA TTATCTTTTGAAGCATAAAAATATATACCAA TGGTATATATTTTTATGCTTCAAAAGATAAA TCTTCTACCCATAATTTAAATGATATTGAAA TATTAATTTCTTTATCTTTTGAAGCATAAAA TATGCTTCAAAAGATAAAGAAATTAATAATA TATCTTTTGAAGCATAAAAATATATACCAAA TATATATTTTTATGCTTCAAAAGATAAAGAA TAATTTCTTTATCTTTTGAAGCATAAAAATA GTATATATTTTTATGCTTCAAAAGATAAAGA GGTTTGGTATATATTTTTATGCTTCAAAAGA CTTTATCTTTTGAAGCATAAAAATATATACC CTTCTTCTACCCATAATTTAAATGATATTGA CTTCTACCCATAATTTAAATGATATTGAAAG CGGGTTTGGTATATATTTTTATGCTTCAAAA CAATATCATTTAAATTATGGGTAGAAGAAGG CAAAGCATACATATTGAAAATTTAAAATCAG ATTTTTATGCTTCAAAAGATAAAGAAATTAA ATTTTAAATTTTCAATATGTATGCTTTGGTC ATTTCTTTATCTTTTGAAGCATAAAAATATA ATTGATATTTTCTTTGGAAATAATATTTTTC ATTAATTTCTTTATCTTTTGAAGCATAAAAA ATCTTTTGAAGCATAAAAATATATACCAAAC AAGATAATCCAAACATGATGATGGCTATTAA AGACCAAAGCATACATATTGAAAATTTAAAA AGAAAAATATTATTTCCAAAGAAAATATCAA ACTTTCAATATCATTTAAATTATGGGTAGAA ACCAAAGCATACATATTGAAAATTTAAAATC ACACTTTCAATATCATTTAAATTATGGGTAG AATTTCTTTATCTTTTGAAGCATAAAAATAT AATATTATTTCCAAAGAAAATATCAATCTAT AATATCATTTAAATTATGGGTAGAAGAAGGT AAGCATACATATTGAAAATTTAAAATCAGAA AAGAAAAATATTATTTCCAAAGAAAATATCA AAATATTATTTCCAAAGAAAATATCAATCTA TAATCAGTATTTCACCTTGTCCGTAACCTGA AAAGCATACATATTGAAAATTTAAAATCAGA AAAATATTATTTCCAAAGAAAATATCAATCT AAAAATATTATTTCCAAAGAAAATATCAATC ATCATACACTTTACCTGAGATTTTGGCATTG TCGTTACTCATGCCATACATAAATGGATAGA TCAAACAACAAATGGATCAAAATTGGGTACA TATGACGTCTATCCATTTATGTATGGCATGA TACCCAATTTTGATCCATTTGTTGTTTGATA GCCATACATAAATGGATAGACGTCATATGAA GACGTCTATCCATTTATGTATGGCATGAGTA CTTCGTTACTCATGCCATACATAAATGGATA CTATCCATTTATGTATGGCATGAGTAACGAA CGTTACTCATGCCATACATAAATGGATAGAC CCCAATTTTGATCCATTTGTTGTTTGATATA CCATACATAAATGGATAGACGTCATATGAAG CCAATTTTGATCCATTTGTTGTTTGATATAG CATACATAAATGGATAGACGTCATATGAAGG CACACCTTCATATGACGTCTATCCATTTATG ATGCCATACATAAATGGATAGACGTCATATG ATGACGTCTATCCATTTATGTATGGCATGAG ATCAAACAACAAATGGATCAAAATTGGGTAC ATATGACGTCTATCCATTTATGTATGGCATG ATAAATGGATAGACGTCATATGAAGGTGTGC AGCACACCTTCATATGACGTCTATCCATTTA AGACTATATCAAACAACAAATGGATCAAAAT ACTCATGCCATACATAAATGGATAGACGTCA ACTATATCAAACAACAAATGGATCAAAATTG ACGTCTATCCATTTATGTATGGCATGAGTAA ACCTTCATATGACGTCTATCCATTTATGTAT ACCCAATTTTGATCCATTTGTTGTTTGATAT ACACCTTCATATGACGTCTATCCATTTATGT AATTTTGATCCATTTGTTGTTTGATATAGTC AACAACAAATGGATCAAAATTGGGTACAAGA AAACAACAAATGGATCAAAATTGGGTACAAG GTTAAAGATGTACAAGATAAAGGAATGGCTA GCTAGCCATTCCTTTATCTTGTACATCTTTA GCATTGTAGCTAGCCATTCCTTTATCTTGTA CTAGCCATTCCTTTATCTTGTACATCTTTAA CATTGTAGCTAGCCATTCCTTTATCTTGTAC ATTGTAGCTAGCCATTCCTTTATCTTGTACA ATGTACAAGATAAAGGAATGGCTAGCTACAA AAGGTATCATCTTGTACCCAATTTTGATCCA AGCCATTCCTTTATCTTGTACATCTTTAACA AGATGTACAAGATAAAGGAATGGCTAGCTAC AGAAATTTGAAAAAGGCATGAAAAAACTAGG ACCTAGTTTTTTCATGCCTTTTTCAAATTTC ACAAGATAAAGGAATGGCTAGCTACAATGCC AATTTGAAAAAGGCATGAAAAAACTAGGTGT AAGATGTACAAGATAAAGGAATGGCTAGCTA AAATTTGAAAAAGGCATGAAAAAACTAGGTG TTAACGTTATTCATTTGTGTTCCTGCTACAA TGTAGCAGGAACACAAATGAATAACGTTAAA GTTGTAGCAGGAACACAAATGAATAACGTTA GCAGGAACACAAATGAATAACGTTAAATTTA ATTTAACGTTATTCATTTGTGTTCCTGCTAC ATAACAAAACATTAGACGATAAAACAAGTTA AATTTAACGTTATTCATTTGTGTTCCTGCTA AAGTTGTAGCAGGAACACAAATGAATAACGT AACTTGTTTTATCGTCTAATGTTTTGTTATT AACGTTATTCATTTGTGTTCCTGCTACAACT AAATTTAACGTTATTCATTTGTGTTCCTGCT TTACAGTGTCACTTTCAACATACAATGAAAA ACTTTACGATAAAAAGCTCCAACATGAAGAT TCTTCATTTTCATTGTATGTTGAAAGTGACA TCATTGTATGTTGAAAGTGACACTGTAACGA TACGGAGAAGAAGTTGTAGCAGGAACACAAA TACAATTTCTTCATTTTCATTGTATGTTGAA TAAATACGGAGAAGAAGTTGTAGCAGGAACA GTTACAGTGTCACTTTCAACATACAATGAAA GTCACTTTCAACATACAATGAAAATGAAGAA GTATGTTGAAAGTGACACTGTAACGAGTCCA GGTAAATACGGAGAAGAAGTTGTAGCAGGAA GGAGAAGAAGTTGTAGCAGGAACACAAATGA GAGAAGAAGTTGTAGCAGGAACACAAATGAA GACTCGTTACAGTGTCACTTTCAACATACAA CTTCATTTTCATTGTATGTTGAAAGTGACAC CTGCTACAACTTCTTCTCCGTATTTACCTTC CTACAACTTCTTCTCCGTATTTACCTTCTTC CGTTACAGTGTCACTTTCAACATACAATGAA CATTTGTGTTCCTGCTACAACTTCTTCTCCG CATTGTATGTTGAAAGTGACACTGTAACGAG CAGTGTCACTTTCAACATACAATGAAAATGA CAATTTCTTCATTTTCATTGTATGTTGAAAG CAACTTCTTCTCCGTATTTACCTTCTTCTAC ATTTTCATTGTATGTTGAAAGTGACACTGTA ATTTCTTCATTTTCATTGTATGTTGAAAGTG ATACGGAGAAGAAGTTGTAGCAGGAACACAA ATACAATTTCTTCATTTTCATTGTATGTTGA AGTGTCACTTTCAACATACAATGAAAATGAA AGAAGGTAAATACGGAGAAGAAGTTGTAGCA AGAAGAAGTTGTAGCAGGAACACAAATGAAT ACTCGTTACAGTGTCACTTTCAACATACAAT ACGGAGAAGAAGTTGTAGCAGGAACACAAAT ACAGTGTCACTTTCAACATACAATGAAAATG ACAATTTCTTCATTTTCATTGTATGTTGAAA AATTTCTTCATTTTCATTGTATGTTGAAAGT AATACGGAGAAGAAGTTGTAGCAGGAACACA AATACAATTTCTTCATTTTCATTGTATGTTG AAGGTAAATACGGAGAAGAAGTTGTAGCAGG AAGAAGTTGTAGCAGGAACACAAATGAATAA AAGAAGGTAAATACGGAGAAGAAGTTGTAGC AACTTCTTCTCCGTATTTACCTTCTTCTACC AAATACGGAGAAGAAGTTGTAGCAGGAACAC AAATACAATTTCTTCATTTTCATTGTATGTT ATGACGCTATGATCCCAATCTAACTTCCACA TTTACTATTTTAGCATTACAGTAATCTAAAA TTATAAACTTGTTTGAAATTTTTATCTTCAA TGTTTACTATTTTAGCATTACAGTAATCTAA TGGGTTAATCAGTATTTCACCTTGTCCGTAA TGAAGATAAAAATTTCAAACAAGTTTATAAA GTTTACTATTTTAGCATTACAGTAATCTAAA GTTATCGCTGAAATTACAAATAAGAAATCCA GTGTTTACTATTTTAGCATTACAGTAATCTA GGTTAATCAGTATTTCACCTTGTCCGTAACC GGGTTAATCAGTATTTCACCTTGTCCGTAAC CTTTTAGATTACTGTAATGCTAAAATAGTAA CTTTATAAACTTGTTTGAAATTTTTATCTTC CGTTATCGCTGAAATTACAAATAAGAAATCC CAGGTTACGGACAAGGTGAAATACTGATTAA ATTTCTTATTTGTAATTTCAGCGATAACGTA ATTGAAGATAAAAATTTCAAACAAGTTTATA AGATTACTGTAATGCTAAAATAGTAAACACT ACTTTTAGATTACTGTAATGCTAAAATAGTA ACGTTATCGCTGAAATTACAAATAAGAAATC AATTGAAGATAAAAATTTCAAACAAGTTTAT AAGATAAAAATTTCAAACAAGTTTATAAAGA AAATTTTTATCTTCAATTGCATCAATAGTAT TACTTTTGCTTTAGTAAGTTTGGCATCTTCA GATGCCAAACTTACTAAAGCAAAAGTAAAAA CATTTTTACTTTTGCTTTAGTAAGTTTGGCA CACTGAAGATGCCAAACTTACTAAAGCAAAA CAAACTTACTAAAGCAAAAGTAAAAATGGTA ATGCCAAACTTACTAAAGCAAAAGTAAAAAT AGATGCCAAACTTACTAAAGCAAAAGTAAAA ACTTTTGCTTTAGTAAGTTTGGCATCTTCAG ACTGAAGATGCCAAACTTACTAAAGCAAAAG ACCATTTTTACTTTTGCTTTAGTAAGTTTGG ACACTGAAGATGCCAAACTTACTAAAGCAAA AAGATGCCAAACTTACTAAAGCAAAAGTAAA AACTTACTAAAGCAAAAGTAAAAATGGTAAA AAACTTACTAAAGCAAAAGTAAAAATGGTAA CTTGCATTTTTATTTTTTTAATTAACGTAAC AATTGAACGTTGCGATCAATGTTACCGTAGT CAATAACTGCATCATCTTTATAGCCTTTATA CAGTGAAGCAATCCGTAACGATGGTTGCTTC CAGTGAAGCAACCATCGTTACGGATTGCTTC AGTGAAGCAATCCGTAACGATGGTTGCTTCA AGTGAAGCAACCATCGTTACGGATTGCTTCA AAGCAATCCGTAACGATGGTTGCTTCACTGT TTGCCAATTAAGTTTGCATAAGATCTATAAA TATTTTCTTTGGAAATAATATTTTTCTTCCA GCCAATTAAGTTTGCATAAGATCTATAAATA GAAGAAAAATATTATTTCCAAAGAAAATATC CAATTAAGTTTGCATAAGATCTATAAATATC ATTTTCTTTGGAAATAATATTTTTCTTCCAA ATTTGCCAATTAAGTTTGCATAAGATCTATA ATATTTTCTTTGGAAATAATATTTTTCTTCC ATAGATCTTATGCAAACTTAATTGGCAAATC TTATAAAATCGATGGTAAAGGTTGGCAAAAA GGACTCGTTACAGTGTCACTTTCAACATACA AAAAAGCTCCAACATGAAGATGGCTATCGTG TGGAAGAACAATTAACAAACTTAAATCAGAA GTGGAAGAACAATTAACAAACTTAAATCAGA GCACTTCTTGATTCTGATTTAAGTTTGTTAA GAAGAACAATTAACAAACTTAAATCAGAATC CTTGATTCTGATTTAAGTTTGTTAATTGTTC CGTTCTGATTTTAAATTTTCAATATGTATGC CGGAAAATACAATTGCATCATTTAAAGCTGC CAATTAACAAACTTAAATCAGAATCAAGAAG ATTCTGATTTAAGTTTGTTAATTGTTCTTCC ATTAACAAACTTAAATCAGAATCAAGAAGTG AGCATACATATTGAAAATTTAAAATCAGAAC AGCAGCTTTAAATGATGCAATTGTATTTTCC AGAACAATTAACAAACTTAAATCAGAATCAA ACGTTCTGATTTTAAATTTTCAATATGTATG ACAATTAACAAACTTAAATCAGAATCAAGAA AATTAACAAACTTAAATCAGAATCAAGAAGT AAGAACAATTAACAAACTTAAATCAGAATCA ACAATGCCAAAATCTCAGGTAAAGTGTATGA AACAATTAACAAACTTAAATCAGAATCAAGA TCATGCCTTTTTCAAATTTCTTACTGCCTAA TATTAATAATTCATAATAAAACAGTGAAGCA TAGGCAGTAAGAAATTTGAAAAAGGCATGAA TAAGAAATTTGAAAAAGGCATGAAAAAACTA TAACGATGGTTGCTTCACTGTTTTATTATGA GTTGCTTCACTGTTTTATTATGAATTATTAA GTTACGGATTGCTTCACTGTTTTGTTATTCA GGTTGCTTCACTGTTTTATTATGAATTATTA GGCAGTAAGAAATTTGAAAAAGGCATGAAAA GCTTCACTGTTTTATTATGAATTATTAATAA GCAGTAAGAAATTTGAAAAAGGCATGAAAAA GATTGCTTCACTGTTTTGTTATTCATCTATA GATGGTTGCTTCACTGTTTTATTATGAATTA GATGAATAACAAAACAGTGAAGCAATCCGTA GATATAGATGAATAACAAAACAGTGAAGCAA CTTCACTGTTTTGTTATTCATCTATATCGTA CTTATTAATAATTCATAATAAAACAGTGAAG CGTTACGGATTGCTTCACTGTTTTGTTATTC CGGATTGCTTCACTGTTTTGTTATTCATCTA CGATATAGATGAATAACAAAACAGTGAAGCA CCGTAACGATGGTTGCTTCACTGTTTTATTA CATCGTTACGGATTGCTTCACTGTTTTGTTA CATAATAAAACAGTGAAGCAACCATCGTTAC CACTTATTAATAATTCATAATAAAACAGTGA CACTGTTTTATTATGAATTATTAATAAGTGC ATTAGGCAGTAAGAAATTTGAAAAAGGCATG ATTAATAATTCATAATAAAACAGTGAAGCAA ATGAATAACAAAACAGTGAAGCAATCCGTAA ATATAGATGAATAACAAAACAGTGAAGCAAT ATAGATGAATAACAAAACAGTGAAGCAATCC ATACGATATAGATGAATAACAAAACAGTGAA ATAATTCATAATAAAACAGTGAAGCAACCAT ATAATAAAACAGTGAAGCAACCATCGTTACG ATAACAAAACAGTGAAGCAATCCGTAACGAT ATAAAACAGTGAAGCAACCATCGTTACGGAT AGTTTTTTCATGCCTTTTTCAAATTTCTTAC AGGCAGTAAGAAATTTGAAAAAGGCATGAAA ACTTATTAATAATTCATAATAAAACAGTGAA ACGGATTGCTTCACTGTTTTGTTATTCATCT ACGATGGTTGCTTCACTGTTTTATTATGAAT ACGATATAGATGAATAACAAAACAGTGAAGC ACAAAACAGTGAAGCAATCCGTAACGATGGT AATTCATAATAAAACAGTGAAGCAACCATCG AATCCGTAACGATGGTTGCTTCACTGTTTTA AATAACAAAACAGTGAAGCAATCCGTAACGA AATAAAACAGTGAAGCAACCATCGTTACGGA AAGAAATTTGAAAAAGGCATGAAAAAACTAG AACGATGGTTGCTTCACTGTTTTATTATGAA AACAGTGAAGCAATCCGTAACGATGGTTGCT AACAAAACAGTGAAGCAATCCGTAACGATGG AAATACGATATAGATGAATAACAAAACAGTG AAACAGTGAAGCAATCCGTAACGATGGTTGC AAACAGTGAAGCAACCATCGTTACGGATTGC AAAACAGTGAAGCAATCCGTAACGATGGTTG AAAACAGTGAAGCAACCATCGTTACGGATTG TTCAACTAACTATTGATGCTAAAGTTCAAAA TATTCAACTAACTATTGATGCTAAAGTTCAA TACCAAGTGATTATCCATTTTATAATGCTCA GGCAAAGATATTCAACTAACTATTGATGCTA GCAAAGATATTCAACTAACTATTGATGCTAA CTTTTGAACTTTAGCATCAATAGTTAGTTGA CTAACTATTGATGCTAAAGTTCAAAAGAGTA CGCCTAAACTATTATATATTTTTATCGGACG AGAAGAAGGTAAATACGGAGAAGAAGTTGTA CATTATAAAATGGATAATCACTTGGTATATC CATCAATAGTTAGTTGAATATCTTTGCCATC CAACTAACTATTGATGCTAAAGTTCAAAAGA CAAAGATATTCAACTAACTATTGATGCTAAA ATTTGAGCATTATAAAATGGATAATCACTTG ATCCATTTATGTATGGCATGAGTAACGAAGA ATTCAACTAACTATTGATGCTAAAGTTCAAA ATATTCAACTAACTATTGATGCTAAAGTTCA ATATACCAAGTGATTATCCATTTTATAATGC ATACTCTTTTGAACTTTAGCATCAATAGTTA AGCATTATAAAATGGATAATCACTTGGTATA AGCATCAATAGTTAGTTGAATATCTTTGCCA AGATGGCAAAGATATTCAACTAACTATTGAT AGATATACCAAGTGATTATCCATTTTATAAT ACTAACTATTGATGCTAAAGTTCAAAAGAGT ACGTCCGATAAAAATATATAATAGTTTAGGC ACGCCTAAACTATTATATATTTTTATCGGAC ACCAAGTGATTATCCATTTTATAATGCTCAA ACAACTATTAAAATAAGTGGAACAATTTTTA AATGATATTGAAAGTGTATGCATGCCAGATG AAGTGATTATCCATTTTATAATGCTCAAATT AAGATATTCAACTAACTATTGATGCTAAAGT AACTTTAGCATCAATAGTTAGTTGAATATCT AACTATTGATGCTAAAGTTCAAAAGAGTATT AACTAACTATTGATGCTAAAGTTCAAAAGAG AAATTGTTCCACTTATTTTAATAGTTGTAGT AAAGATGGCAAAGATATTCAACTAACTATTG AAAGATATTCAACTAACTATTGATGCTAAAG AAAATTGTTCCACTTATTTTAATAGTTGTAG AAAAGATGGCAAAGATATTCAACTAACTATT AAAAATTGTTCCACTTATTTTAATAGTTGTA ATAAAATCGATGGTAAAGGTTGGCAAAAAGA GGGTACAGAAAAACTAGACTTGATTACAAAA GGGGTACAGAAAAACTAGACTTGATTACAAA ATTGTGGCATGATTTCTTCTGCAAGTTTAAC CCATTTTGTAATCAAGTCTAGTTTTTCTGTA CATTTTGTAATCAAGTCTAGTTTTTCTGTAC CAGATAAGGGGTACAGAAAAACTAGACTTGA CAGAAAAACTAGACTTGATTACAAAATGGAG CAAGTCTAGTTTTTCTGTACCCCTTATCTGC ATCGAAAGTTGGCAAATGTTCATCTTTGAAT ATTTTGTAATCAAGTCTAGTTTTTCTGTACC ATAAGGGGTACAGAAAAACTAGACTTGATTA AGGGGTACAGAAAAACTAGACTTGATTACAA AGCTCCATTTTGTAATCAAGTCTAGTTTTTC AGAAAAACTAGACTTGATTACAAAATGGAGC AATTGCAGATAAGGGGTACAGAAAAACTAGA AATCAAGTCTAGTTTTTCTGTACCCCTTATC AAGTCTAGTTTTTCTGTACCCCTTATCTGCA AAGGGGTACAGAAAAACTAGACTTGATTACA AACTAGACTTGATTACAAAATGGAGCTTGGG AAACTAGACTTGATTACAAAATGGAGCTTGG AAAAACTAGACTTGATTACAAAATGGAGCTT CTATTATATATTTTTATCGGACGTTCAGTCA CATACACTTTCAATATCATTTAAATTATGGG TTATAATCTTTTTTAGATACATTCTTTGGAA TCCAGTCTTCACGAAACGAAGTTGTATGGAA TCATAATTCAATTCAGTTATTTCCCCGGACA TACTGCAGAACTCAAAATGAAACAAGGAGAA TACAACTTCGTTTCGTGAAGACTGGAGAACA TAATCTTTTTTAGATACATTCTTTGGAACGA TAACTGAATTGAATTATGATGAAATTAAAGA GTTCCAAAGAATGTATCTAAAAAAGATTATA GTCTTCACGAAACGAAGTTGTATGGAATATA GTACTGCAGAACTCAAAATGAAACAAGGAGA GGGGAAATAACTGAATTGAATTATGATGAAA GAATGTATCTAAAAAAGATTATAAAGCAATC GAAATAACTGAATTGAATTATGATGAAATTA CTTCACGAAACGAAGTTGTATGGAATATAAC CTCTCCTTGCATTTTTATTTTTTTAATTAAC CGTTAATTAAAAAAATAAAAATGCAAGGAGA CGTATTTACCTTCTTCTACCCATAATTTAAA CGGGGAAATAACTGAATTGAATTATGATGAA CCTCTCCTTGCATTTTTATTTTTTTAATTAA CCGGGGAAATAACTGAATTGAATTATGATGA CCATACAACTTCGTTTCGTGAAGACTGGAGA CCAAAGAATGTATCTAAAAAAGATTATAAAG CATTTAAATTATGGGTAGAAGAAGGTAAATA CATACAACTTCGTTTCGTGAAGACTGGAGAA CAGTCTTCACGAAACGAAGTTGTATGGAATA CAAAGAATGTATCTAAAAAAGATTATAAAGC ATTTACCTTCTTCTACCCATAATTTAAATGA ATTTAAATTATGGGTAGAAGAAGGTAAATAC ATTCCATACAACTTCGTTTCGTGAAGACTGG ATTACCTCTCCTTGCATTTTTATTTTTTTAA ATTAAAAAAATAAAAATGCAAGGAGAGGTAA ATCATTTAAATTATGGGTAGAAGAAGGTAAA ATACAACTTCGTTTCGTGAAGACTGGAGAAC ATAACTGAATTGAATTATGATGAAATTAAAG ATAAAAATGCAAGGAGAGGTAATATGCTAAC AGTTATATTCCATACAACTTCGTTTCGTGAA AGTTAGCATATTACCTCTCCTTGCATTTTTA AGTGTTCTCCAGTCTTCACGAAACGAAGTTG AGTCTTCACGAAACGAAGTTGTATGGAATAT AGAATGTATCTAAAAAAGATTATAAAGCAAT TAAAAAAATAAAAATGCAAGGAGAGGTAATA ACTGCAGAACTCAAAATGAAACAAGGAGAAA ACTGAATTGAATTATGATGAAATTAAAGATG ACCTCTCCTTGCATTTTTATTTTTTTAATTA ACAACTTCGTTTCGTGAAGACTGGAGAACAC AATTTCATCATAATTCAATTCAGTTATTTCC AATGTATCTAAAAAAGATTATAAAGCAATCG AATCTTTTTTAGATACATTCTTTGGAACGAT AATAACTGAATTGAATTATGATGAAATTAAA ATGTCCGGGGAAATAACTGAATTGAATTATG AATAAAAATGCAAGGAGAGGTAATATGCTAA AAGAATGTATCTAAAAAAGATTATAAAGCAA AACTGAATTGAATTATGATGAAATTAAAGAT AAATAACTGAATTGAATTATGATGAAATTAA AAATAAAAATGCAAGGAGAGGTAATATGCTA AAAGAATGTATCTAAAAAAGATTATAAAGCA AAAATGCAAGGAGAGGTAATATGCTAACTGT AAAATAAAAATGCAAGGAGAGGTAATATGCT AAAAATGCAAGGAGAGGTAATATGCTAACTG AAAAATAAAAATGCAAGGAGAGGTAATATGC AAAAAATAAAAATGCAAGGAGAGGTAATATG AAAAAAATAAAAATGCAAGGAGAGGTAATAT TCTGCTCAACAAGTTCCAGATTACAACTTCA CTGGCATGCATACACTTTCAATATCATTTAA GCTCAACAAGTTCCAGATTACAACTTCACCA CTGCTCAACAAGTTCCAGATTACAACTTCAC CTCAACAAGTTCCAGATTACAACTTCACCAG GCTTTTAGAAATATAACTGCTATCTTTATAA AAGGCTTTTTGTTTTGAATGTTTCTCCTACT CTTTTAGAAATATAACTGCTATCTTTATAAA CGCTTTTAGAAATATAACTGCTATCTTTATA CATTATCGCTTTTAGAAATATAACTGCTATC CAAGTTTATAAAGATAGCAGTTATATTTCTA ATATAACTGCTATCTTTATAAACTTGTTTGA ATAACTGCTATCTTTATAAACTTGTTTGAAA ATAAAGATAGCAGTTATATTTCTAAAAGCGA AGCAGTTATATTTCTAAAAGCGATAATGGTG AGATAGCAGTTATATTTCTAAAAGCGATAAT ACCATTATCGCTTTTAGAAATATAACTGCTA ACAAGTTTATAAAGATAGCAGTTATATTTCT AATATAACTGCTATCTTTATAAACTTGTTTG AAGTTTATAAAGATAGCAGTTATATTTCTAA AACTGCTATCTTTATAAACTTGTTTGAAATT ACTGATTATCATTCATGATGATTATTTAGAA AAAGATAGCAGTTATATTTCTAAAAGCGATA AAACAAGTTTATAAAGATAGCAGTTATATTT TATTTAAGGGAGAAGTAACAGCACTTATTAA TCATCTTTTGTAATTGCAACATCTAACTCCA ACGCACCTCACTTATTAAAAGACACGAAAAA GTTGTTCATCTTTTGTAATTGCAACATCTAA GTTAGATGTTGCAATTACAAAAGATGAACAA GTAATTGCAACATCTAACTCCAACCAGTTTA GGTTGGAGTTAGATGTTGCAATTACAAAAGA GGTATAAACTGGTTGGAGTTAGATGTTGCAA GGAGTTAGATGTTGCAATTACAAAAGATGAA GCAGTTATATTTCTAAAAGCGATAATGGTGA CTTTTGTAATTGCAACATCTAACTCCAACCA CTGGTTGGAGTTAGATGTTGCAATTACAAAA CATCTTTTGTAATTGCAACATCTAACTCCAA CAGTTATATTTCTAAAAGCGATAATGGTGAA CAACATCTAACTCCAACCAGTTTATACCTTC ATTGCAACATCTAACTCCAACCAGTTTATAC ATCTTTTGTAATTGCAACATCTAACTCCAAC ATAAACTGGTTGGAGTTAGATGTTGCAATTA AGTTGTTCATCTTTTGTAATTGCAACATCTA AGTTATATTTCTAAAAGCGATAATGGTGAAG AGTTAGATGTTGCAATTACAAAAGATGAACA AGGTATAAACTGGTTGGAGTTAGATGTTGCA AGATGTTGCAATTACAAAAGATGAACAACTG ACTTCACCATTATCGCTTTTAGAAATATAAC AATTGCAACATCTAACTCCAACCAGTTTATA CACTTTCAATATCATTTAAATTATGGGTAGA AAGGTATAAACTGGTTGGAGTTAGATGTTGC AAGCCTTCATATTACAGAAGAAGAAATTATC AACATCTAACTCCAACCAGTTTATACCTTCT AAACTGGTTGGAGTTAGATGTTGCAATTACA TCGTCTAATGTTTTGTTATTTAACCCAATCA ATGATTGGGTTAAATAACAAAACATTAGACG ATAAAAAGCTCCAACATGAAGATGGCTATCG CAATTTGCAACAACTTTTGATCCTCAATATA ATATTGAGGATCAAAAGTTGTTGCAAATTGG AGGTAAATACGGAGAAGAAGTTGTAGCAGGA TGGTAATATCGACTTAAAACAAGCAATAGAA TGAAGTGGTAAATGGTAATATCGACTTAAAA TCGACTTAAAACAAGCAATAGAATCATCAGA TCATAGCGTCATTATTCCAGGAATGCAGAAA TATGAAGTGGTAAATGGTAATATCGACTTAA TATCGACTTAAAACAAGCAATAGAATCATCA TAATATCGACTTAAAACAAGCAATAGAATCA GTCTTTCTGCATTCCTGGAATAATGACGCTA GTAAATGGTAATATCGACTTAAAACAAGCAA GGTAAATGGTAATATCGACTTAAAACAAGCA GGGATCATAGCGTCATTATTCCAGGAATGCA GCTTGTTTTAAGTCGATATTACCATTTACCA GCATTCCTGGAATAATGACGCTATGATCCCA GATTGGGATCATAGCGTCATTATTCCAGGAA GATTCTATTGCTTGTTTTAAGTCGATATTAC GATGAATATCATAAATAAAGAAGTCGATAGA GATCATAGCGTCATTATTCCAGGAATGCAGA GAATATCATAAATAAAGAAGTCGATAGATTC GAAGTGGTAAATGGTAATATCGACTTAAAAC CTTGTTTTAAGTCGATATTACCATTTACCAC CTGCATTCCTGGAATAATGACGCTATGATCC CCTGGAATAATGACGCTATGATCCCAATCTA CATTCCTGGAATAATGACGCTATGATCCCAA CATAGCGTCATTATTCCAGGAATGCAGAAAG CATAATCAATACGAATCTATCGACTTCTTTA CAATACGAATCTATCGACTTCTTTATTTATG ATTGCTTGTTTTAAGTCGATATTACCATTTA ATTCCTGGAATAATGACGCTATGATCCCAAT ATGGTAATATCGACTTAAAACAAGCAATAGA ACTTTCTGTTTCATTAGTTGTAAGATGAAAT ATGAAGTGGTAAATGGTAATATCGACTTAAA ATCGACTTAAAACAAGCAATAGAATCATCAG ATATGAAGTGGTAAATGGTAATATCGACTTA ATAGCGTCATTATTCCAGGAATGCAGAAAGA CAACATGAAGATGGCTATCGTGTCACAATCG ATACGAATCTATCGACTTCTTTATTTATGAT ATAAATAAAGAAGTCGATAGATTCGTATTGA ATAAAGAAGTCGATAGATTCGTATTGATTAT AGTTAGATTGGGATCATAGCGTCATTATTCC AGTGGTAAATGGTAATATCGACTTAAAACAA GAAGATGGTATGTGGAAGTTAGATTGGGATC AGCGTCATTATTCCAGGAATGCAGAAAGACC AGAAGTCGATAGATTCGTATTGATTATGGAG ACGAATCTATCGACTTCTTTATTTATGATAT AATGGTAATATCGACTTAAAACAAGCAATAG AATATCGACTTAAAACAAGCAATAGAATCAT AATATCATAAATAAAGAAGTCGATAGATTCG AATACGAATCTATCGACTTCTTTATTTATGA AATAAAGAAGTCGATAGATTCGTATTGATTA AAGTGGTAAATGGTAATATCGACTTAAAACA AAGTCGATATTACCATTTACCACTTCATATC AAGAAGTCGATAGATTCGTATTGATTATGGA AAATGGTAATATCGACTTAAAACAAGCAATA AAATAAAGAAGTCGATAGATTCGTATTGATT AAAGAAGTCGATAGATTCGTATTGATTATGG AAATATATAATAGTTTAGGCGTTAAAGATAT TTAAAACAAACTACGGTAACATTGATCGCAA TGGCTAGCTACAATGCCAAAATCTCAGGTAA TCTGCAGGATCTTGGTTTGGTGAAAAATTCA GTTACCGTAGTTTGTTTTAATTTTATATTGA GGCTAGCTACAATGCCAAAATCTCAGGTAAA ATACAATGAAAATGAAGAAATTGTATTTAAG GATGCTTCTGCAGGATCTTGGTTTGGTGAAA GACCAACATAACCTAATAGATGTGAAGTCGC GAATTTTTCACCAAACCAAGATCCTGCAGAA CTTTGAATTTTTCACCAAACCAAGATCCTGC CTGCAGGATCTTGGTTTGGTGAAAAATTCAA CTGAGATTTTGGCATTGTAGCTAGCCATTCC CTCAATATAAAATTAAAACAAACTACGGTAA CGTAGTTTGTTTTAATTTTATATTGAGCATC AATAGCCATCATCATGTTTGGATTATCTTTA CCTGAGATTTTGGCATTGTAGCTAGCCATTC CCAAGATCCTGCAGAAGCATCTTTAATTTCA CCAAACCAAGATCCTGCAGAAGCATCTTTAA CAGGATCTTGGTTTGGTGAAAAATTCAAAGA CACTTTACCTGAGATTTTGGCATTGTAGCTA CAATGTTACCGTAGTTTGTTTTAATTTTATA CAATATAAAATTAAAACAAACTACGGTAACA ATTTTTCACCAAACCAAGATCCTGCAGAAGC ATTAAAGATGCTTCTGCAGGATCTTGGTTTG ATTAAAACAAACTACGGTAACATTGATCGCA AAAAGAGTATTTATAACAACATGAAAAATGA ATGGCTAGCTACAATGCCAAAATCTCAGGTA ATGCTTCTGCAGGATCTTGGTTTGGTGAAAA ATGCTCAATATAAAATTAAAACAAACTACGG ATGAAATTAAAGATGCTTCTGCAGGATCTTG ATCAATGTTACCGTAGTTTGTTTTAATTTTA ATAAAATTAAAACAAACTACGGTAACATTGA AGGATCTTGGTTTGGTGAAAAATTCAAAGAT AGGAATGGCTAGCTACAATGCCAAAATCTCA AGATGCTTCTGCAGGATCTTGGTTTGGTGAA ACTTTACCTGAGATTTTGGCATTGTAGCTAG ACCAAGATCCTGCAGAAGCATCTTTAATTTC ACCAACATAACCTAATAGATGTGAAGTCGCT ACCAAACCAAGATCCTGCAGAAGCATCTTTA ACACTTTACCTGAGATTTTGGCATTGTAGCT ACAAACTACGGTAACATTGATCGCAACGTTC AATTTTTCACCAAACCAAGATCCTGCAGAAG AAGTGCTGTTACTTCTCCCTTAAATACAATT AATTAAAACAAACTACGGTAACATTGATCGC AATGTTACCGTAGTTTGTTTTAATTTTATAT AAGATCCTGCAGAAGCATCTTTAATTTCATC ACCTGAATCAGCTAATAATATTTCATTATCT AACAAACTACGGTAACATTGATCGCAACGTT AAATTAAAGATGCTTCTGCAGGATCTTGGTT AAATTAAAACAAACTACGGTAACATTGATCG AAACCAAGATCCTGCAGAAGCATCTTTAATT AAACAAACTACGGTAACATTGATCGCAACGT TTATACCTTCTACTTCTGAAGCAGCTTTAAA TTAAAGCTGCTTCAGAAGTAGAAGGTATAAA TGTATGATGAGCTATATGAGAACGGTAATAA TGCATCATTTAAAGCTGCTTCAGAAGTAGAA TCTACTTCTGAAGCAGCTTTAAATGATGCAA TATGATGAGCTATATGAGAACGGTAATAAAA TACCTTCTACTTCTGAAGCAGCTTTAAATGA GTTTATACCTTCTACTTCTGAAGCAGCTTTA GTGTATGATGAGCTATATGAGAACGGTAATA GTATTTTTTATTACCGTTCTCATATAGCTCA GTATGATGAGCTATATGAGAACGGTAATAAA GAACGGTAATAAAAAATACGATATAGATGAA CTTCTACTTCTGAAGCAGCTTTAAATGATGC CTATATGAGAACGGTAATAAAAAATACGATA CTATATCGTATTTTTTATTACCGTTCTCATA CGTATTTTTTATTACCGTTCTCATATAGCTC CAGCACGTGCAAACCAACTTGCTAATTGGGG CATCTATATCGTATTTTTTATTACCGTTCTC ATTTAAAGCTGCTTCAGAAGTAGAAGGTATA ATTGCATCATTTAAAGCTGCTTCAGAAGTAG ATGATGAGCTATATGAGAACGGTAATAAAAA ATGAGCTATATGAGAACGGTAATAAAAAATA ATGAGAACGGTAATAAAAAATACGATATAGA ATCTATATCGTATTTTTTATTACCGTTCTCA ATCGTATTTTTTATTACCGTTCTCATATAGC ATATGAGAACGGTAATAAAAAATACGATATA ATACCTTCTACTTCTGAAGCAGCTTTAAATG ATACAATTGCATCATTTAAAGCTGCTTCAGA AGTTACGACTTTCTGTTTCATTAGTTGTAAG AGTGTATGATGAGCTATATGAGAACGGTAAT AGCTGCTTCAGAAGTAGAAGGTATAAACTGG AGCTATATGAGAACGGTAATAAAAAATACGA AGAACGGTAATAAAAAATACGATATAGATGA ACTTCTGAAGCAGCTTTAAATGATGCAATTG ACCTTCTACTTCTGAAGCAGCTTTAAATGAT AATACAATTGCATCATTTAAAGCTGCTTCAG AAGTGTATGATGAGCTATATGAGAACGGTAA AAGCTGCTTCAGAAGTAGAAGGTATAAACTG AAGCAGCTTTAAATGATGCAATTGTATTTTC AACGGTAATAAAAAATACGATATAGATGAAT AAATACAATTGCATCATTTAAAGCTGCTTCA AAAGTGTATGATGAGCTATATGAGAACGGTA AAAGCTGCTTCAGAAGTAGAAGGTATAAACT TCGTAAAGTTTTTCGAGTCCCTTTTTACCAA TAAAGTTTTTCGAGTCCCTTTTTACCAATAA TAAAAAGGGACTCGAAAAACTTTACGATAAA GTAAAGTTTTTCGAGTCCCTTTTTACCAATA GGTAAAAAGGGACTCGAAAAACTTTACGATA GCAGTTATTGGTAAAAAGGGACTCGAAAAAC ATTGGTAAAAAGGGACTCGAAAAACTTTACG ATCGTAAAGTTTTTCGAGTCCCTTTTTACCA AGTTTTTCGAGTCCCTTTTTACCAATAACTG AAGTTTTTCGAGTCCCTTTTTACCAATAACT AAGGGACTCGAAAAACTTTACGATAAAAAGC AAAATACAATTGCATCATTTAAAGCTGCTTC AAATTGCAGATAAGGGGTACAGAAAAACTAG AAAGTTTTTCGAGTCCCTTTTTACCAATAAC AAAAGGGACTCGAAAAACTTTACGATAAAAA AAAAAGGGACTCGAAAAACTTTACGATAAAA ATTTCAAACAAGTTTATAAAGATAGCAGTTA TTACATACTAAAAAATTAATTTGAATAAGAA TACTAAAAAATTAATTTGAATAAGAAAGAGA TACATACTAAAAAATTAATTTGAATAAGAAA TAACATGTTACATACTAAAAAATTAATTTGA GTTACATACTAAAAAATTAATTTGAATAAGA CTTTACTAGGTAATCCTCTATGTCCATATAC CTTATTCAAATTAATTTTTTAGTATGTAACA CTGTATATGGACATAGAGGATTACCTAGTAA ACCCATAATTTAAATGATATTGAAAGTGTAT CATGTTACATACTAAAAAATTAATTTGAATA CATACTAAAAAATTAATTTGAATAAGAAAGA ATGTTACATACTAAAAAATTAATTTGAATAA ATACTAAAAAATTAATTTGAATAAGAAAGAG ACTGTATATGGACATAGAGGATTACCTAGTA ACCCGCTTCTTTTACCATTTTTACTTTTGCT ACATGTTACATACTAAAAAATTAATTTGAAT ACATACTAAAAAATTAATTTGAATAAGAAAG AAGCAAAAGTAAAAATGGTAAAAGAAGCGGG AACATGTTACATACTAAAAAATTAATTTGAA AGACACGAAAAACAAAGTTTGGAAGAAAAAT TTTATCTATATGCATATATTGAGGATCAAAA TGCATATATTGAGGATCAAAAGTTGTTGCAA TGATCCTCAATATATGCATATAGATAAAGAA TCTTTATCTATATGCATATATTGAGGATCAA AACAGTGAAGCAACCATCGTTACGGATTGCT TCCTCAATATATGCATATAGATAAAGAAAAA GCAACAACTTTTGATCCTCAATATATGCATA GATCCTCAATATATGCATATAGATAAAGAAA CTTTATCTATATGCATATATTGAGGATCAAA CTCAATATATGCATATAGATAAAGAAAAAGC CCTCAATATATGCATATAGATAAAGAAAAAG CAATATATGCATATAGATAAAGAAAAAGCAG CAACTTTTGATCCTCAATATATGCATATAGA ATTTGCAACAACTTTTGATCCTCAATATATG ATGCATATATTGAGGATCAAAAGTTGTTGCA ATCCTCAATATATGCATATAGATAAAGAAAA ATTATTAATTTCTTTATCTTTTGAAGCATAA ACTTTTGATCCTCAATATATGCATATAGATA AATTTGCAACAACTTTTGATCCTCAATATAT AACAAATGGATCAAAATTGGGTACAAGATGA AACTTTTGATCCTCAATATATGCATATAGAT AACAACTTTTGATCCTCAATATATGCATATA TCTTATTTGTAATTTCAGCGATAACGTACAA TCCATTTTTTTAACGGTTTTAAGTGGAACGA TCCACTTAAAACCGTTAAAAAAATGGATGAA TCATCCATTTTTTTAACGGTTTTAAGTGGAA TACCTTCGTTCCACTTAAAACCGTTAAAAAA GTAATACATTGTACGTTATCGCTGAAATTAC GGTAATACATTGTACGTTATCGCTGAAATTA GCGATAACGTACAATGTATTACCTGGGTATA GATGATACCTTCGTTCCACTTAAAACCGTTA GATAACGTACAATGTATTACCTGGGTATACA CGATAACGTACAATGTATTACCTGGGTATAC CCTGTATACCCAGGTAATACATTGTACGTTA CCCAGGTAATACATTGTACGTTATCGCTGAA CCATTTTTTTAACGGTTTTAAGTGGAACGAA CCAGGTAATACATTGTACGTTATCGCTGAAA CATTTTTTTAACGGTTTTAAGTGGAACGAAG CATTGTACGTTATCGCTGAAATTACAAATAA CATCCATTTTTTTAACGGTTTTAAGTGGAAC CAGCGATAACGTACAATGTATTACCTGGGTA CACTTAAAACCGTTAAAAAAATGGATGAATA ATTTTTTTAACGGTTTTAAGTGGAACGAAGG ATTTGTAATTTCAGCGATAACGTACAATGTA ATTTCAGCGATAACGTACAATGTATTACCTG ATTGTACGTTATCGCTGAAATTACAAATAAG AACCATCGTTACGGATTGCTTCACTGTTTTG ATTCATCCATTTTTTTAACGGTTTTAAGTGG AAGCAACCATCGTTACGGATTGCTTCACTGT ATGATACCTTCGTTCCACTTAAAACCGTTAA ATCCATTTTTTTAACGGTTTTAAGTGGAACG ATACCTTCGTTCCACTTAAAACCGTTAAAAA ATACATTGTACGTTATCGCTGAAATTACAAA ATAACGTACAATGTATTACCTGGGTATACAG AGCGATAACGTACAATGTATTACCTGGGTAT ACTTAAAACCGTTAAAAAAATGGATGAATAT ACCTTCGTTCCACTTAAAACCGTTAAAAAAA ACCCAGGTAATACATTGTACGTTATCGCTGA ACATTGTACGTTATCGCTGAAATTACAAATA AATTTCAGCGATAACGTACAATGTATTACCT AATACATTGTACGTTATCGCTGAAATTACAA ATTAATAAGTGCTGTTACTTCTCCCTTAAAT AACGTACAATGTATTACCTGGGTATACAGGT AACGGTTTTAAGTGGAACGAAGGTATCATCT GCATATATTGAGGATCAAAAGTTGTTGCAAA AAACCGTTAAAAAAATGGATGAATATTTAAG AAAACCGTTAAAAAAATGGATGAATATTTAA TGTATTGCTATTATCGTCAACGATTGTGACA TATCGTGTCACAATCGTTGACGATAATAGCA GTCACAATCGTTGACGATAATAGCAATACAA GTCAACGATTGTGACACGATAGCCATCTTCA GTATTGCTATTATCGTCAACGATTGTGACAC GGCTATCGTGTCACAATCGTTGACGATAATA GATGGCTATCGTGTCACAATCGTTGACGATA AATATAAAATTAAAACAAACTACGGTAACAT CTATTATCGTCAACGATTGTGACACGATAGC CTATCGTGTCACAATCGTTGACGATAATAGC CGTGTCACAATCGTTGACGATAATAGCAATA CGTCAACGATTGTGACACGATAGCCATCTTC TAAAACCGTTAAAAAAATGGATGAATATTTA CACAATCGTTGACGATAATAGCAATACAATC CAATCGTTGACGATAATAGCAATACAATCGC CAACGATTGTGACACGATAGCCATCTTCATG ATTGTATTGCTATTATCGTCAACGATTGTGA ATTGCTATTATCGTCAACGATTGTGACACGA ATTATCGTCAACGATTGTGACACGATAGCCA ATGAAGATGGCTATCGTGTCACAATCGTTGA CTTTAATGTTGTGCTTGTTAAACTTGCAGAA ATCGTGTCACAATCGTTGACGATAATAGCAA AGATGGCTATCGTGTCACAATCGTTGACGAT ACAATCGTTGACGATAATAGCAATACAATCG AACGATTGTGACACGATAGCCATCTTCATGT TTCATTTGCTATTTTTACTACATCATCGAAA TGACGATAATAGCAATACAATCGCACATACA TCGTTGACGATAATAGCAATACAATCGCACA CTATAAAGATGATGCAGTTATTGGTAAAAAG TATTCATTTGCTATTTTTACTACATCATCGA TAGTAAAAATAGCAAATGAATATAATATGAA GTTGACGATAATAGCAATACAATCGCACATA GTATGTGCGATTGTATTGCTATTATCGTCAA GTAGTAAAAATAGCAAATGAATATAATATGA ATCTATCGACTTCTTTATTTATGATATTCAT GATGTAGTAAAAATAGCAAATGAATATAATA GATGATGTAGTAAAAATAGCAAATGAATATA GATAATAGCAATACAATCGCACATACATTAA CTTTCGATGATGTAGTAAAAATAGCAAATGA ATAGCAGTTATATTTCTAAAAGCGATAATGG CGATAATAGCAATACAATCGCACATACATTA AGATAAGGGGTACAGAAAAACTAGACTTGAT AATGGCTAGCTACAATGCCAAAATCTCAGGT CATATTATATTCATTTGCTATTTTTACTACA CAACTTTCGATGATGTAGTAAAAATAGCAAA ATTCATTTGCTATTTTTACTACATCATCGAA ATTATATTCATTTGCTATTTTTACTACATCA ATGTGCGATTGTATTGCTATTATCGTCAACG ATGTATGTGCGATTGTATTGCTATTATCGTC ATGATGTAGTAAAAATAGCAAATGAATATAA ATCGTTGACGATAATAGCAATACAATCGCAC ATATTCATTTGCTATTTTTACTACATCATCG ATATTATATTCATTTGCTATTTTTACTACAT AGTAAAAATAGCAAATGAATATAATATGAAT ACTTTCGATGATGTAGTAAAAATAGCAAATG ACCAGTTTATACCTTCTACTTCTGAAGCAGC AATTCATATTATATTCATTTGCTATTTTTAC AATGTATGTGCGATTGTATTGCTATTATCGT AATAGCAATACAATCGCACATACATTAATAG AACTTTCGATGATGTAGTAAAAATAGCAAAT AAATTCATATTATATTCATTTGCTATTTTTA AAATAGCAAATGAATATAATATGAATTTAAA ATCTCAGGTAAAGTGTATGATGAGCTATATG AAAATAGCAAATGAATATAATATGAATTTAA ATATATTTTTATGCTTCAAAAGATAAAGAAA AAAAATAGCAAATGAATATAATATGAATTTA TCAAATTTCAAACAAAAATTTAGATAATGAA TAATATTTCATTATCTAAATTTTTGTTTGAA ATCAATACGAATCTATCGACTTCTTTATTTA CTCAAATTTCAAACAAAAATTTAGATAATGA CATTATCTAAATTTTTGTTTGAAATTTGAGC CAATTCAGTTATTTCCCCGGACATATTTGTA CAAATTTCAAACAAAAATTTAGATAATGAAA CAAATATGTCCGGGGAAATAACTGAATTGAA ATTATCTAAATTTTTGTTTGAAATTTGAGCA ATGCTCAAATTTCAAACAAAAATTTAGATAA ATATTTCATTATCTAAATTTTTGTTTGAAAT ATAATTCAATTCAGTTATTTCCCCGGACATA ATAATATTTCATTATCTAAATTTTTGTTTGA AGCTAATAATATTTCATTATCTAAATTTTTG ACAAATATGTCCGGGGAAATAACTGAATTGA ACAAAAATTTAGATAATGAAATATTATTAGC AATTTCAAACAAAAATTTAGATAATGAAATA AATTCAGTTATTTCCCCGGACATATTTGTAG AATATGTCCGGGGAAATAACTGAATTGAATT AATAATATTTCATTATCTAAATTTTTGTTTG AACAAAAATTTAGATAATGAAATATTATTAG AAATTTCAAACAAAAATTTAGATAATGAAAT AAATTTAGATAATGAAATATTATTAGCTGAT AAATATGTCCGGGGAAATAACTGAATTGAAT AAACAAAAATTTAGATAATGAAATATTATTA AAAATTTAGATAATGAAATATTATTAGCTGA AAAAATTTAGATAATGAAATATTATTAGCTG ATTTTCTTTGCTAGAGTAGCACTCGAATTAG AGAGTTAATGGGACCAACATAACCTAATAGA GTAATCAAGTCTAGTTTTTCTGTACCCCTTA TGAAATTACAAATAAGAAATCCATAAAAAAA TCGCTGAAATTACAAATAAGAAATCCATAAA TATCGCTGAAATTACAAATAAGAAATCCATA GCTGAAATTACAAATAAGAAATCCATAAAAA GAGTCCATTTTCTTTTTTTATGGATTTCTTA CTTTTTTTATGGATTTCTTATTTGTAATTTC CAAATAAGAAATCCATAAAAAAAGAAAATGG ATTTTCTTTTTTTATGGATTTCTTATTTGTA ATTACAAATAAGAAATCCATAAAAAAAGAAA ATGGATTTCTTATTTGTAATTTCAGCGATAA ATCGCTGAAATTACAAATAAGAAATCCATAA CCTTAAATACAATTTCTTCATTTTCATTGTA AGTCCATTTTCTTTTTTTATGGATTTCTTAT ACGAGTCCATTTTCTTTTTTTATGGATTTCT ACAAATAAGAAATCCATAAAAAAAGAAAATG TAATACATTGTACGTTATCGCTGAAATTACA AATAAGAAATCCATAAAAAAAGAAAATGGAC AAGAAATCCATAAAAAAAGAAAATGGACTCG AAATTACAAATAAGAAATCCATAAAAAAAGA AAATAAGAAATCCATAAAAAAAGAAAATGGA TATTTCATATATGTCTCTCTTTCTTATTCAA GGACAAGGTGAAATACTGATTAACCCAGTAC GCTATAGATTGAAAGGATCTGTACTGGGTTA GACAAGGTGAAATACTGATTAACCCAGTACA CTATAGATTGAAAGGATCTGTACTGGGTTAA CTAAAAAATTAATTTGAATAAGAAAGAGAGA CGTATTTCATATATGTCTCTCTTTCTTATTC CGGACAAGGTGAAATACTGATTAACCCAGTA CATCGTATTTCATATATGTCTCTCTTTCTTA CATATATGTCTCTCTTTCTTATTCAAATTAA CAAGGTGAAATACTGATTAACCCAGTACAGA ATTTGAATAAGAAAGAGAGACATATATGAAA ATTTCATATATGTCTCTCTTTCTTATTCAAA ATTGAAAGGATCTGTACTGGGTTAATCAGTA ATTAACCCAGTACAGATCCTTTCAATCTATA ATATATGTCTCTCTTTCTTATTCAAATTAAT ATAGATTGAAAGGATCTGTACTGGGTTAATC ATACTGATTAACCCAGTACAGATCCTTTCAA ATAAGAAAGAGAGACATATATGAAATACGAT AGGTGAAATACTGATTAACCCAGTACAGATC AGGATCTGTACTGGGTTAATCAGTATTTCAC ATAATGACGCTATGATCCCAATCTAACTTCC AGATTGAAAGGATCTGTACTGGGTTAATCAG AGAAAGAGAGACATATATGAAATACGATGAT ACTAAAAAATTAATTTGAATAAGAAAGAGAG ACGGACAAGGTGAAATACTGATTAACCCAGT ACAAGGTGAAATACTGATTAACCCAGTACAG AATTTGAATAAGAAAGAGAGACATATATGAA AATACTGATTAACCCAGTACAGATCCTTTCA AATAAGAAAGAGAGACATATATGAAATACGA AAGGTGAAATACTGATTAACCCAGTACAGAT AAGGATCTGTACTGGGTTAATCAGTATTTCA AAGAAAGAGAGACATATATGAAATACGATGA AACCCAGTACAGATCCTTTCAATCTATAGCG AAATTAATTTGAATAAGAAAGAGAGACATAT AAATACTGATTAACCCAGTACAGATCCTTTC AAAATTAATTTGAATAAGAAAGAGAGACATA AAAATCATCGTATTTCATATATGTCTCTCTT AAAAATTAATTTGAATAAGAAAGAGAGACAT AAAAAATTAATTTGAATAAGAAAGAGAGACA TTAAAAAGAGATGAATATCATAAATAAAGAA TGATATTCATCTCTTTTTAATGGAAATAAAA TCCATTAAAAAGAGATGAATATCATAAATAA TCATCTCTTTTTAATGGAAATAAAAGTGCGA TATTTCCATTAAAAAGAGATGAATATCATAA TATTTATGATATTCATCTCTTTTTAATGGAA TATGATATTCATCTCTTTTTAATGGAAATAA CAAAAAAATTTCATCTTACAACTAATGAAAC CTTTTATTTCCATTAAAAAGAGATGAATATC CTTTAAATGATGCAATTGTATTTTCCGGAGC CTTCTTTATTTATGATATTCATCTCTTTTTA TCTTCTGCAAGTTTAACAAGCACAACATTAA CTCCGGAAAATACAATTGCATCATTTAAAGC CGCACTTTTATTTCCATTAAAAAGAGATGAA CCATTAAAAAGAGATGAATATCATAAATAAA CATTAAAAAGAGATGAATATCATAAATAAAG CAGCTTTAAATGATGCAATTGTATTTTCCGG CACTTTTATTTCCATTAAAAAGAGATGAATA ATTTCCATTAAAAAGAGATGAATATCATAAA ATTTATGATATTCATCTCTTTTTAATGGAAA ATTCATCTCTTTTTAATGGAAATAAAAGTGC ATTAAAAAGAGATGAATATCATAAATAAAGA ATGATATTCATCTCTTTTTAATGGAAATAAA ATCGCACTTTTATTTCCATTAAAAAGAGATG AGCTCCGGAAAATACAATTGCATCATTTAAA AATCGCACTTTTATTTCCATTAAAAAGAGAT AAGAGATGAATATCATAAATAAAGAAGTCGA AAAGAGATGAATATCATAAATAAAGAAGTCG AAAAGAGATGAATATCATAAATAAAGAAGTC AAAAAGAGATGAATATCATAAATAAAGAAGT GAAACAATGTGGAATTGGCCAATACAGGAAC CTGTATTGGCCAATTCCACATTGTTTCGGTC CCGAAACAATGTGGAATTGGCCAATACAGGA GAAATTATCCAATTTGCAACAACTTTTGATC ATTTCATCATAATTCAATTCAGTTATTTCCC ATATGTCCGGGGAAATAACTGAATTGAATTA AAAACAAACTACGGTAACATTGATCGCAACG TTTGGAAGAAAAATATTATTTCCAAAGAAAA ACCGAAACAATGTGGAATTGGCCAATACAGG ACAATGTGGAATTGGCCAATACAGGAACAGC AACAATGTGGAATTGGCCAATACAGGAACAG AAACAATGTGGAATTGGCCAATACAGGAACA TATTAATGTTAAAGATGTACAAGATAAAGGA CTTTATCTTGTACATCTTTAACATTAATAGC CATTCCTTTATCTTGTACATCTTTAACATTA ATTCCTTTATCTTGTACATCTTTAACATTAA ATGTTAAAGATGTACAAGATAAAGGAATGGC AATGTTAAAGATGTACAAGATAAAGGAATGG TGTATATGGACATAGAGGATTACCTAGTAAA GGACTACAAATATGTCCGGGGAAATAACTGA GAGCTTTTTATCGTAAAGTTTTTCGAGTCCC GACTACAAATATGTCCGGGGAAATAACTGAA CAGTTATTTCCCCGGACATATTTGTAGTCCG CTGCCTAATTCGAGTGCTACTCTAGCAAAGA AGCTTTTTATCGTAAAGTTTTTCGAGTCCCT ACTACAAATATGTCCGGGGAAATAACTGAAT TTAACGCACCTCACTTATTAAAAGACACGAA TAGAAAATAATGGCAATATTAACGCACCTCA TAATAAGTGAGGTGCGTTAATATTGCCATTA TAACGCACCTCACTTATTAAAAGACACGAAA CGCTGAAATTACAAATAAGAAATCCATAAAA GCATTAGAAAATAATGGCAATATTAACGCAC GCAATATTAACGCACCTCACTTATTAAAAGA GAGGTGCGTTAATATTGCCATTATTTTCTAA CTTTTAATAAGTGAGGTGCGTTAATATTGCC CGTGTCTTTTAATAAGTGAGGTGCGTTAATA CGCATTAGAAAATAATGGCAATATTAACGCA CATTAGAAAATAATGGCAATATTAACGCACC CAATATTAACGCACCTCACTTATTAAAAGAC ATTAACGCACCTCACTTATTAAAAGACACGA ATATTAACGCACCTCACTTATTAAAAGACAC ATGGTATGTGGAAGTTAGATTGGGATCATAG AGTGAGGTGCGTTAATATTGCCATTATTTTC AGGTGCGTTAATATTGCCATTATTTTCTAAT AGAAAATAATGGCAATATTAACGCACCTCAC ATGGCAATATTAACGCACCTCACTTATTAAA AATGGCAATATTAACGCACCTCACTTATTAA AATATTAACGCACCTCACTTATTAAAAGACA AATAATGGCAATATTAACGCACCTCACTTAT AATAAGTGAGGTGCGTTAATATTGCCATTAT AACGCACCTCACTTATTAAAAGACACGAAAA AAATAATGGCAATATTAACGCACCTCACTTA AAAATAATGGCAATATTAACGCACCTCACTT GACAACTACAACTATTAAAATAAGTGGAACA CGACAACTACAACTATTAAAATAAGTGGAAC CCGACAACTACAACTATTAAAATAAGTGGAA CCCGACAACTACAACTATTAAAATAAGTGGA ATTGTTCCACTTATTTTAATAGTTGTAGTTG ATAATAGCAATACAATCGCACATACATTAAT ACAACTACAACTATTAAAATAAGTGGAACAA AACTACAACTATTAAAATAAGTGGAACAATT TTAAATTTATTAAACCTGTATACCCAGGTAA TGAAGACTATATCAAACAACAAATGGATCAA TCGGTTAATTTATTATATTCTTCGTTACTCA TCCATTTGTTGTTTGATATAGTCTTCAGAAA TATACAGGTTTAATAAATTTAACGTTATTCA TAGTCTTCAGAAATACTTAGTTCTTTAGCGA TAAGTATTTCTGAAGACTATATCAAACAACA TAACGTTAAATTTATTAAACCTGTATACCCA GTTAAATTTATTAAACCTGTATACCCAGGTA AGAAGTTGTAGCAGGAACACAAATGAATAAC GTAACGAAGAATATAATAAATTAACCGAAGA GGCATGAGTAACGAAGAATATAATAAATTAA GGAACACAAATGAATAACGTTAAATTTATTA GCTAAAGAACTAAGTATTTCTGAAGACTATA GCATGAGTAACGAAGAATATAATAAATTAAC GATCCATTTGTTGTTTGATATAGTCTTCAGA GAGTAACGAAGAATATAATAAATTAACCGAA GAATAACGTTAAATTTATTAAACCTGTATAC GAACTAAGTATTTCTGAAGACTATATCAAAC GAACACAAATGAATAACGTTAAATTTATTAA CTTTTTTATCTTCGGTTAATTTATTATATTC CTGAAGACTATATCAAACAACAAATGGATCA CTAAGTATTTCTGAAGACTATATCAAACAAC CGAAGAATATAATAAATTAACCGAAGATAAA CATTTGTTGTTTGATATAGTCTTCAGAAATA CATGAGTAACGAAGAATATAATAAATTAACC CACAAATGAATAACGTTAAATTTATTAAACC ACCTTGTCCGTAACCTGAATCAGCTAATAAT ATTTGTTGTTTGATATAGTCTTCAGAAATAC ATTTCTGAAGACTATATCAAACAACAAATGG ATTACCTGGGTATACAGGTTTAATAAATTTA ATGAGTAACGAAGAATATAATAAATTAACCG ATCTTCGGTTAATTTATTATATTCTTCGTTA ATCCATTTGTTGTTTGATATAGTCTTCAGAA ATATAGTCTTCAGAAATACTTAGTTCTTTAG ATATAATAAATTAACCGAAGATAAAAAAGAA ATAGTCTTCAGAAATACTTAGTTCTTTAGCG ATACAGGTTTAATAAATTTAACGTTATTCAT ATAATAAATTAACCGAAGATAAAAAAGAACC ATAACGTTAAATTTATTAAACCTGTATACCC ATAAATTTAACGTTATTCATTTGTGTTCCTG AGTAACGAAGAATATAATAAATTAACCGAAG AGGTTCTTTTTTATCTTCGGTTAATTTATTA AGAATATAATAAATTAACCGAAGATAAAAAA AGAACTAAGTATTTCTGAAGACTATATCAAA ACTAAGTATTTCTGAAGACTATATCAAACAA ACGTTAAATTTATTAAACCTGTATACCCAGG ACGAAGAATATAATAAATTAACCGAAGATAA ACCTGGGTATACAGGTTTAATAAATTTAACG ACACAAATGAATAACGTTAAATTTATTAAAC ACAAATGAATAACGTTAAATTTATTAAACCT AATTTATTATATTCTTCGTTACTCATGCCAT AATTTATTAAACCTGTATACCCAGGTAATAC AATGAATAACGTTAAATTTATTAAACCTGTA AATATAATAAATTAACCGAAGATAAAAAAGA AATAACGTTAAATTTATTAAACCTGTATACC AATAAATTTAACGTTATTCATTTGTGTTCCT AATAAATTAACCGAAGATAAAAAAGAACCTC AAGTATTTCTGAAGACTATATCAAACAACAA AAGACTATATCAAACAACAAATGGATCAAAA AAGAATATAATAAATTAACCGAAGATAAAAA AAGAACTAAGTATTTCTGAAGACTATATCAA AACGTTAAATTTATTAAACCTGTATACCCAG AACGAAGAATATAATAAATTAACCGAAGATA AACACAAATGAATAACGTTAAATTTATTAAA AAATTTATTAAACCTGTATACCCAGGTAATA AAATGAATAACGTTAAATTTATTAAACCTGT AAAGAACTAAGTATTTCTGAAGACTATATCA TGGTTAAGCAAGTGGAAGAACAATTAACAAA TAAGTGGAACAATTTTTATCTTTTTCATCAA TAAGCAAGTGGAAGAACAATTAACAAACTTA GGTTAAGCAAGTGGAAGAACAATTAACAAAC GAAAAAGATAAAAATTGTTCCACTTATTTTA CAAGTGGAAGAACAATTAACAAACTTAAATC ATGGTTAAGCAAGTGGAAGAACAATTAACAA AGTTTGTTAATTGTTCTTCCACTTGCTTAAC AGCAAGTGGAAGAACAATTAACAAACTTAAA AATAAGTGGAACAATTTTTATCTTTTTCATC AAGTGGAACAATTTTTATCTTTTTCATCAAT AAGCAAGTGGAAGAACAATTAACAAACTTAA AAGATAAAAATTGTTCCACTTATTTTAATAG AAATAAGTGGAACAATTTTTATCTTTTTCAT AAAGATAAAAATTGTTCCACTTATTTTAATA AAAATAAGTGGAACAATTTTTATCTTTTTCA AAAAGATAAAAATTGTTCCACTTATTTTAAT AAAAAGATAAAAATTGTTCCACTTATTTTAA ACGAGTAGATGCTCAATATAAAATTAAAACA CAAATGGATCAAAATTGGGTACAAGATGATA TCACATTAATCGCACTTTTATTTCCATTAAA TAATGGAAATAAAAGTGCGATTAATGTGATA TAATCGCACTTTTATTTCCATTAAAAAGAGA GTTAATATTGCCATTATTTTCTAATGCGCTA GCGCATTAGAAAATAATGGCAATATTAACGC CATTAATCGCACTTTTATTTCCATTAAAAAG CACATTAATCGCACTTTTATTTCCATTAAAA ATTAATCGCACTTTTATTTCCATTAAAAAGA ATCTATAGCGCATTAGAAAATAATGGCAATA ATCACATTAATCGCACTTTTATTTCCATTAA ATATTGCCATTATTTTCTAATGCGCTATAGA ATAGCGCATTAGAAAATAATGGCAATATTAA AGCGCATTAGAAAATAATGGCAATATTAACG ACATTAATCGCACTTTTATTTCCATTAAAAA AATGGAAATAAAAGTGCGATTAATGTGATAA AATATTGCCATTATTTTCTAATGCGCTATAG TATGCATATAGATAAAGAAAAAGCAGAACAA TATAGATAAAGAAAAAGCAGAACAAAGTAGA TAATAAAAAATACGATATAGATGAATAACAA TAAAGAAAAAGCAGAACAAAGTAGATTTAAA GTTTTGTTATTCATCTATATCGTATTTTTTA GTTTCTCCTACTATAAAATCATCGTATTTCA GTAATAAAAAATACGATATAGATGAATAACA GGTAATAAAAAATACGATATAGATGAATAAC GATAAAGAAAAAGCAGAACAAAGTAGATTTA GACATATATGAAATACGATGATTTTATAGTA GAAATACGATGATTTTATAGTAGGAGAAACA GAAAAAGCAGAACAAAGTAGATTTAAAGGTA CTCCTACTATAAAATCATCGTATTTCATATA CCAAGTGATTATCCATTTTATAATGCTCAAA CTATAAAATCATCGTATTTCATATATGTCTC CGGTAATAAAAAATACGATATAGATGAATAA CATATATGAAATACGATGATTTTATAGTAGG CATATAGATAAAGAAAAAGCAGAACAAAGTA ATGAAATACGATGATTTTATAGTAGGAGAAA ATATGCATATAGATAAAGAAAAAGCAGAACA ATATGAAATACGATGATTTTATAGTAGGAGA ATATATGCATATAGATAAAGAAAAAGCAGAA ATATATGAAATACGATGATTTTATAGTAGGA ATATAGATAAAGAAAAAGCAGAACAAAGTAG ATAGATAAAGAAAAAGCAGAACAAAGTAGAT ATAAAGAAAAAGCAGAACAAAGTAGATTTAA ATAAAATCATCGTATTTCATATATGTCTCTC AGAGAGACATATATGAAATACGATGATTTTA AGAGACATATATGAAATACGATGATTTTATA ACTTTGTTCTGCTTTTTCTTTATCTATATGC ACTATAAAATCATCGTATTTCATATATGTCT ACGGTAATAAAAAATACGATATAGATGAATA ACCTTTAAATCTACTTTGTTCTGCTTTTTCT AATCTACTTTGTTCTGCTTTTTCTTTATCTA AATATATGCATATAGATAAAGAAAAAGCAGA AATACGATGATTTTATAGTAGGAGAAACATT AATAAAAAATACGATATAGATGAATAACAAA AAGCAGAACAAAGTAGATTTAAAGGTATCAT AAGAAAAAGCAGAACAAAGTAGATTTAAAGG AAATCTACTTTGTTCTGCTTTTTCTTTATCT AAATACGATGATTTTATAGTAGGAGAAACAT AAAGCAGAACAAAGTAGATTTAAAGGTATCA AAAGAAAAAGCAGAACAAAGTAGATTTAAAG AAAATACGATATAGATGAATAACAAAACAGT AAAAGCAGAACAAAGTAGATTTAAAGGTATC AAAAATACGATATAGATGAATAACAAAACAG AAAAAGCAGAACAAAGTAGATTTAAAGGTAT AAAAAATACGATATAGATGAATAACAAAACA TCTTTATGTGTTTTATTTACGACTTGTTGCA TATGCAACAAGTCGTAAATAAAACACATAAA TGTGGCATGATTTCTTCTGCAAGTTTAACAA TAAATATCTTCTTTATGTGTTTTATTTACGA CGAAACAATGTGGAATTGGCCAATACAGGAA GTATGCAACAAGTCGTAAATAAAACACATAA GTAAATAAAACACATAAAGAAGATATTTATA GGTATGCAACAAGTCGTAAATAAAACACATA ATGGCTATCGTGTCACAATCGTTGACGATAA CTATAAATATCTTCTTTATGTGTTTTATTTA CAAGTCGTAAATAAAACACATAAAGAAGATA CAACAAGTCGTAAATAAAACACATAAAGAAG ATGTGTTTTATTTACGACTTGTTGCATACCA ATGCAACAAGTCGTAAATAAAACACATAAAG ATAAAACACATAAAGAAGATATTTATAGATC AGATCTATAAATATCTTCTTTATGTGTTTTA ACAAGTCGTAAATAAAACACATAAAGAAGAT AATATCTTCTTTATGTGTTTTATTTACGACT AATAAAACACATAAAGAAGATATTTATAGAT AAGTCGTAAATAAAACACATAAAGAAGATAT AAATATCTTCTTTATGTGTTTTATTTACGAC AAATAAAACACATAAAGAAGATATTTATAGA AAACACATAAAGAAGATATTTATAGATCTTA AAAACACATAAAGAAGATATTTATAGATCTT TCTTTACAGACAATGCAGATAAAATGGTGCA CATTTTCTTTGCTAGAGTAGCACTCGAATTA ACCTGGTGAAGTTGTAATCTGGAACTTGTTG GAGATGAATATCATAAATAAAGAAGTCGATA ATGCACCATTTTATCTGCATTGTCTGTAAAG ATGATTTTTTAAAAATGAGATGAGACGTAGA CCTTTATCTTGTACATCTTTAACATTAATAG ATCTACGTCTCATCTCATTTTTAAAAAATCA GTGAAGCAACCATCGTTACGGATTGCTTCAC GATAAAAAGCTCCAACATGAAGATGGCTATC ATCTTTTTGCCAACCTTTACCATCGATTTTA TTATCTGCATTGTCTGTAAAGATACCATCAA TGATGGTATCTTTACAGACAATGCAGATAAA GTTGATGGTATCTTTACAGACAATGCAGATA GATGGTATCTTTACAGACAATGCAGATAAAA AAATATTAACAGCAATGATTGGGTTAAATAA GAGTTGATGGTATCTTTACAGACAATGCAGA CTGCATTGTCTGTAAAGATACCATCAACTCC CCATTTTATCTGCATTGTCTGTAAAGATACC CATTTTATCTGCATTGTCTGTAAAGATACCA ATGGTATCTTTACAGACAATGCAGATAAAAT ATCGCTTTTAGAAATATAACTGCTATCTTTA ATACATATTGAAAATTTAAAATCAGAACGTG AGTTGATGGTATCTTTACAGACAATGCAGAT AGTAAGAAATTTGAAAAAGGCATGAAAAAAC AGAGATGAATATCATAAATAAAGAAGTCGAT TTTTATAGTAGGAGAAACATTCAAAACAAAA TTTATAGTAGGAGAAACATTCAAAACAAAAA TGATTTTATAGTAGGAGAAACATTCAAAACA GCTTTTTGTTTTGAATGTTTCTCCTACTATA GATTTTATAGTAGGAGAAACATTCAAAACAA CTTTTTGTTTTGAATGTTTCTCCTACTATAA ATTTTATAGTAGGAGAAACATTCAAAACAAA ATGATTTTATAGTAGGAGAAACATTCAAAAC ATAGTAGGAGAAACATTCAAAACAAAAAGCC AGGCTTTTTGTTTTGAATGTTTCTCCTACTA CTTTACCTGAGATTTTGGCATTGTAGCTAGC TTAAATAACAAAACATTAGACGATAAAACAA TGGGTTAAATAACAAAACATTAGACGATAAA GTTAAATAACAAAACATTAGACGATAAAACA GGTTAAATAACAAAACATTAGACGATAAAAC GGGTTAAATAACAAAACATTAGACGATAAAA GACTTACCTTTAACATGTTACATACTAAAAA CTTGTTTTATCGTCTAATGTTTTGTTATTTA ATTGGGTTAAATAACAAAACATTAGACGATA ATCGTCTAATGTTTTGTTATTTAACCCAATC AGACTTACCTTTAACATGTTACATACTAAAA ACTTACCTTTAACATGTTACATACTAAAAAA ATCCGGTACTGCAGAACTCAAAATGAAACAA TTATAGATCTTATGCAAACTTAATTGGCAAA TTAAATCAGAATCAAGAAGTGCTCATTTCAA TATCTAAAAAAGATTATAAAGCAATCGCTAA TAAAACAAAAAGAATATAAAGGCTATAAAGA TAAAAAAGATTATAAAGCAATCGCTAAAGAA GTATCTAAAAAAGATTATAAAGCAATCGCTA GATTATAAAGCAATCGCTAAAGAACTAAGTA GAAGTGCTCATTTCAAGCTTTAATGTTGTGC ACGACTTTCTGTTTCATTAGTTGTAAGATGA CTTTATAGCCTTTATATTCTTTTTGTTTTAA GGTACAAGATGATACCTTCGTTCCACTTAAA CTTTAGCGATTGCTTTATAATCTTTTTTAGA CTAAAAAAGATTATAAAGCAATCGCTAAAGA CAATTGAAGATAAAAATTTCAAACAAGTTTA CAGCACTTATTAATAATTCATAATAAAACAG CAGAATCAAGAAGTGCTCATTTCAAGCTTTA CAACATTAAAGCTTGAAATGAGCACTTCTTG ATTAAAGCTTGAAATGAGCACTTCTTGATTC ATTAAAACAAAAAGAATATAAAGGCTATAAA ATCTAAAAAAGATTATAAAGCAATCGCTAAA ATACTTAGTTCTTTAGCGATTGCTTTATAAT AGCGATTGCTTTATAATCTTTTTTAGATACA AGCACTTCTTGATTCTGATTTAAGTTTGTTA AGAATCAAGAAGTGCTCATTTCAAGCTTTAA AGAAGTGCTCATTTCAAGCTTTAATGTTGTG ACTTAGTTCTTTAGCGATTGCTTTATAATCT ACTTAAATCAGAATCAAGAAGTGCTCATTTC ACTGTTTTATTATGAATTATTAATAAGTGCT ACATTAAAGCTTGAAATGAGCACTTCTTGAT ACAGCACTTATTAATAATTCATAATAAAACA ATATCGACTTAAAACAAGCAATAGAATCATC ACAAACTTAAATCAGAATCAAGAAGTGCTCA AATTAAAACAAAAAGAATATAAAGGCTATAA AATCAGAATCAAGAAGTGCTCATTTCAAGCT AAGTGCTCATTTCAAGCTTTAATGTTGTGCT AAGCTTGAAATGAGCACTTCTTGATTCTGAT AAGATTATAAAGCAATCGCTAAAGAACTAAG AAGAATTAAAACAAAAAGAATATAAAGGCTA AAGAAGTGCTCATTTCAAGCTTTAATGTTGT AACATTAAAGCTTGAAATGAGCACTTCTTGA AACAAACTTAAATCAGAATCAAGAAGTGCTC AAATGAGCACTTCTTGATTCTGATTTAAGTT AAATCAGAATCAAGAAGTGCTCATTTCAAGC AAAGATTATAAAGCAATCGCTAAAGAACTAA AAACTTAAATCAGAATCAAGAAGTGCTCATT AAACAAAAAGAATATAAAGGCTATAAAGATG AAAAGATTATAAAGCAATCGCTAAAGAACTA AAAACAAAAAGAATATAAAGGCTATAAAGAT AAAAAGATTATAAAGCAATCGCTAAAGAACT AAAAAAGATTATAAAGCAATCGCTAAAGAAC TATGAAATACGATGATTTTATAGTAGGAGAA AGGAACAGCATATGAGATAGGCATCGTTCCA AACATTAATAGCCATCATCATGTTTGGATTA CAGTTATATTCCATACAACTTCGTTTCGTGA AATAAGTGCTGTTACTTCTCCCTTAAATACA ACTATTTTAGCATTACAGTAATCTAAAAGTG ACACTTTTAGATTACTGTAATGCTAAAATAG CTGGAATAATGACGCTATGATCCCAATCTAA TTCCCCGGACATATTTGTAGTCCGTTCTAAA TTAGAACGGACTACAAATATGTCCGGGGAAA TGAGGATCAAAAGTTGTTGCAAATTGGATAA TATTGAGGATCAAAAGTTGTTGCAAATTGGA TATCCAATTTGCAACAACTTTTGATCCTCAA GTCCGTTCTAAATAATCATCATGAATGATAA GTAGTCCGTTCTAAATAATCATCATGAATGA GGACATATTTGTAGTCCGTTCTAAATAATCA GAACGGACTACAAATATGTCCGGGGAAATAA CGGACATATTTGTAGTCCGTTCTAAATAATC CCCCGGACATATTTGTAGTCCGTTCTAAATA CATTCATGATGATTATTTAGAACGGACTACA CATATTTGTAGTCCGTTCTAAATAATCATCA ATTTGTAGTCCGTTCTAAATAATCATCATGA ATTTCCCCGGACATATTTGTAGTCCGTTCTA ATTTAGAACGGACTACAAATATGTCCGGGGA ATTCATGATGATTATTTAGAACGGACTACAA ATTATTTAGAACGGACTACAAATATGTCCGG ATTATCCAATTTGCAACAACTTTTGATCCTC GTTAGATTGGGATCATAGCGTCATTATTCCA ATCCAATTTGCAACAACTTTTGATCCTCAAT ATCATTCATGATGATTATTTAGAACGGACTA ATATTTGTAGTCCGTTCTAAATAATCATCAT AGTCCGTTCTAAATAATCATCATGAATGATA AGAACGGACTACAAATATGTCCGGGGAAATA ACATATTTGTAGTCCGTTCTAAATAATCATC TAAAGATGATGCAGTTATTGGTAAAAAGGGA AACGGACTACAAATATGTCCGGGGAAATAAC TATAATAGTTTAGGCGTTAAAGATATAAACA TGAGATGAGACGTAGATTAACTCCATAATCA TAAAAATGAGATGAGACGTAGATTAACTCCA GTCGATAGATTCGTATTGATTATGGAGTTAA GTAGATTAACTCCATAATCAATACGAATCTA CCAAAGCATACATATTGAAAATTTAAAATCA GATGAGACGTAGATTAACTCCATAATCAATA GAGACGTAGATTAACTCCATAATCAATACGA CGTATTGATTATGGAGTTAATCTACGTCTCA CGATAGATTCGTATTGATTATGGAGTTAATC ATTCGTATTGATTATGGAGTTAATCTACGTC ATTAACTCCATAATCAATACGAATCTATCGA ATGAGATGAGACGTAGATTAACTCCATAATC ATGAGACGTAGATTAACTCCATAATCAATAC ATAGATTCGTATTGATTATGGAGTTAATCTA AGTCGATAGATTCGTATTGATTATGGAGTTA AGATTCGTATTGATTATGGAGTTAATCTACG AGATTAACTCCATAATCAATACGAATCTATC AGATGAGACGTAGATTAACTCCATAATCAAT AGACGTAGATTAACTCCATAATCAATACGAA ACGTAGATTAACTCCATAATCAATACGAATC CCCGGACATATTTGTAGTCCGTTCTAAATAA AATGAGATGAGACGTAGATTAACTCCATAAT AAGATGCTTCTGCAGGATCTTGGTTTGGTGA AACTCCATAATCAATACGAATCTATCGACTT AAAATGAGATGAGACGTAGATTAACTCCATA AAAAATGAGATGAGACGTAGATTAACTCCAT TGTTTGGATTATCTTTATCATATGATATAAA GTTTATATCATATGATAAAGATAATCCAAAC GGTTTATATCATATGATAAAGATAATCCAAA GACACGAAAAACAAAGTTTGGAAGAAAAATA CATGTTTGGATTATCTTTATCATATGATATA CAAAGTTTGGAAGAAAAATATTATTTCCAAA ATGTTTGGATTATCTTTATCATATGATATAA ATAATATTTTTCTTCCAAACTTTGTTTTTCG AGTTTGGAAGAAAAATATTATTTCCAAAGAA ACGAAAAACAAAGTTTGGAAGAAAAATATTA ACACGAAAAACAAAGTTTGGAAGAAAAATAT ACAAAGTTTGGAAGAAAAATATTATTTCCAA AATAATATTTTTCTTCCAAACTTTGTTTTTC AAGTTTGGAAGAAAAATATTATTTCCAAAGA AACAAAGTTTGGAAGAAAAATATTATTTCCA AAAGTTTGGAAGAAAAATATTATTTCCAAAG AAACAAAGTTTGGAAGAAAAATATTATTTCC AAAACAAAGTTTGGAAGAAAAATATTATTTC AAAAACAAAGTTTGGAAGAAAAATATTATTT CTTTTGAAGCATAAAAATATATACCAAACCC AATATTTTTCTTCCAAACTTTGTTTTTCGTG AATATTCATCCATTTTTTTAACGGTTTTAAG GGATTTGCCAATTAAGTTTGCATAAGATCTA AAAAAGCCTTCATATTACAGAAGAAGAAATT ACTGGTTGGAGTTAGATGTTGCAATTACAAA CAAACTACGGTAACATTGATCGCAACGTTCA CCATTTTTACTTTTGCTTTAGTAAGTTTGGC GAAGAATATAATAAATTAACCGAAGATAAAA ATTAATGTTAAAGATGTACAAGATAAAGGAA AAAGACACGAAAAACAAAGTTTGGAAGAAAA CTTTTGATCCTCAATATATGCATATAGATAA CACCTTGTCCGTAACCTGAATCAGCTAATAA TGGATAGACGTCATATGAAGGTGTGCTTACA TGAAGGTGTGCTTACAAGTGCTAATAATTCA TCATTTCAAGCTTTAATGTTGTGCTTGTTAA TATTAGCACTTGTAAGCACACCTTCATATGA TAGGCATCGTTCCAAAGAATGTATCTAAAAA GGATAGACGTCATATGAAGGTGTGCTTACAA GCATCGTTCCAAAGAATGTATCTAAAAAAGA GATAGGCATCGTTCCAAAGAATGTATCTAAA GAGATAGGCATCGTTCCAAAGAATGTATCTA ACCCGACAACTACAACTATTAAAATAAGTGG CTTTTTTAGATACATTCTTTGGAACGATGCC CTTGTAAGCACACCTTCATATGACGTCTATC CTCATTTCAAGCTTTAATGTTGTGCTTGTTA CGTCATATGAAGGTGTGCTTACAAGTGCTAA TGGCAATATTAACGCACCTCACTTATTAAAA CATTTCAAGCTTTAATGTTGTGCTTGTTAAA CATTCTTTGGAACGATGCCTATCTCATATGC CATATGAAGGTGTGCTTACAAGTGCTAATAA CAGGTGAATTATTAGCACTTGTAAGCACACC CAGCATATGAGATAGGCATCGTTCCAAAGAA CACTTGTAAGCACACCTTCATATGACGTCTA CAAGTTTAACAAGCACAACATTAAAGCTTGA CAAGCACAACATTAAAGCTTGAAATGAGCAC ATTTCAAGCTTTAATGTTGTGCTTGTTAAAC AGATTGGGATCATAGCGTCATTATTCCAGGA ATTAGCACTTGTAAGCACACCTTCATATGAC ATGGATAGACGTCATATGAAGGTGTGCTTAC ATGAAGGTGTGCTTACAAGTGCTAATAATTC ATCTTTTTTAGATACATTCTTTGGAACGATG AATATTTCATTATCTAAATTTTTGTTTGAAA ATATGAGATAGGCATCGTTCCAAAGAATGTA ATATGAAGGTGTGCTTACAAGTGCTAATAAT ATAGGCATCGTTCCAAAGAATGTATCTAAAA ATACATTCTTTGGAACGATGCCTATCTCATA AACTAAGTATTTCTGAAGACTATATCAAACA AGCATATGAGATAGGCATCGTTCCAAAGAAT AGCACTTGTAAGCACACCTTCATATGACGTC AGATAGGCATCGTTCCAAAGAATGTATCTAA AGATACATTCTTTGGAACGATGCCTATCTCA AGACGTCATATGAAGGTGTGCTTACAAGTGC ACGTCATATGAAGGTGTGCTTACAAGTGCTA ACATTCTTTGGAACGATGCCTATCTCATATG ACAGGTGAATTATTAGCACTTGTAAGCACAC ACAGCATATGAGATAGGCATCGTTCCAAAGA ACAAGCACAACATTAAAGCTTGAAATGAGCA AATTATTAGCACTTGTAAGCACACCTTCATA AATGGATAGACGTCATATGAAGGTGTGCTTA GCATGATTTCTTCTGCAAGTTTAACAAGCAC AAGTTTAACAAGCACAACATTAAAGCTTGAA AAGGTGTGCTTACAAGTGCTAATAATTCACC AAGCACAACATTAAAGCTTGAAATGAGCACT AACAAGCACAACATTAAAGCTTGAAATGAGC AAATGGATAGACGTCATATGAAGGTGTGCTT CTTCTGTAATATGAAGGCTTTTTGTTTTGAA AAAACTAGACTTGATTACAAAATGGAGCTTG TAGCATTACAGTAATCTAAAAGTGTTCTCCA TAATCTAAAAGTGTTCTCCAGTCTTCACGAA GTTTATAAAGATAGCAGTTATATTTCTAAAA TAAAAGTGTTCTCCAGTCTTCACGAAACGAA GTAATCTAAAAGTGTTCTCCAGTCTTCACGA GAGAACACTTTTAGATTACTGTAATGCTAAA GAAGACTGGAGAACACTTTTAGATTACTGTA CTAAAAGTGTTCTCCAGTCTTCACGAAACGA CGTTTCGTGAAGACTGGAGAACACTTTTAGA CATTACAGTAATCTAAAAGTGTTCTCCAGTC CAGTAATCTAAAAGTGTTCTCCAGTCTTCAC ATTTTAGCATTACAGTAATCTAAAAGTGTTC CAACTCAAAAAATATTAACAGCAATGATTGG ATCTAAAAGTGTTCTCCAGTCTTCACGAAAC AGTAATCTAAAAGTGTTCTCCAGTCTTCACG AGCATTACAGTAATCTAAAAGTGTTCTCCAG TAATATTGCCATTATTTTCTAATGCGCTATA AGACTGGAGAACACTTTTAGATTACTGTAAT AGAACACTTTTAGATTACTGTAATGCTAAAA ACTGGAGAACACTTTTAGATTACTGTAATGC ACAGTAATCTAAAAGTGTTCTCCAGTCTTCA AATCTAAAAGTGTTCTCCAGTCTTCACGAAA CGCACCTCACTTATTAAAAGACACGAAAAAC AAAATTAAAACAAACTACGGTAACATTGATC AAGACTGGAGAACACTTTTAGATTACTGTAA ACCGTAGTTTGTTTTAATTTTATATTGAGCA AACTTCGTTTCGTGAAGACTGGAGAACACTT AACACTTTTAGATTACTGTAATGCTAAAATA AAAGTGTTCTCCAGTCTTCACGAAACGAAGT ATTTAAGTTTGTTAATTGTTCTTCCACTTGC AAAAGTGTTCTCCAGTCTTCACGAAACGAAG TTAGATACTTTTTTTATTTTACGATCCTGAA TCGTAAAATAAAAAAAGTATCTAAAAATAAA TCAGGATCGTAAAATAAAAAAAGTATCTAAA GTAAAATAAAAAAAGTATCTAAAAATAAAAA CGTAAAATAAAAAAAGTATCTAAAAATAAAA CAGGATCGTAAAATAAAAAAAGTATCTAAAA ATTTTTAGATACTTTTTTTATTTTACGATCC ATTCAGGATCGTAAAATAAAAAAAGTATCTA TGATGAGCTATATGAGAACGGTAATAAAAAA ATCGTAAAATAAAAAAAGTATCTAAAAATAA ATAAAAAAAGTATCTAAAAATAAAAAACGAG ACATATATGAAATACGATGATTTTATAGTAG AGATACTTTTTTTATTTTACGATCCTGAATG ACATTCAGGATCGTAAAATAAAAAAAGTATC AATAAAAAAAGTATCTAAAAATAAAAAACGA AAAATAAAAAAAGTATCTAAAAATAAAAAAC AAATATTCATCCATTTTTTTAACGGTTTTAA TATCATTTAAATTATGGGTAGAAGAAGGTAA GCAGAAGCATCTTTAATTTCATCATAATTCA GAATTATGATGAAATTAAAGATGCTTCTGCA CTGAATTGAATTATGATGAAATTAAAGATGC CAGAAGCATCTTTAATTTCATCATAATTCAA ATCATATGATAAAGATAATCCAAACATGATG ATGATGAAATTAAAGATGCTTCTGCAGGATC TCAGGTAAAGTGTATGATGAGCTATATGAGA ATCCTGCAGAAGCATCTTTAATTTCATCATA ATATCATTTAAATTATGGGTAGAAGAAGGTA AAAGGATCTGTACTGGGTTAATCAGTATTTC AGCATCTTTAATTTCATCATAATTCAATTCA AGATCCTGCAGAAGCATCTTTAATTTCATCA AGAAGCATCTTTAATTTCATCATAATTCAAT ATCATAATTCAATTCAGTTATTTCCCCGGAC AATTGAATTATGATGAAATTAAAGATGCTTC AATTATGATGAAATTAAAGATGCTTCTGCAG AAGCATCTTTAATTTCATCATAATTCAATTC AAAATTGCAGATAAGGGGTACAGAAAAACTA TATCCACCCTCAAACAGGTGAATTATTAGCA TAATTCACCTGTTTGAGGGTGGATAGCAGTA TAATAATTCACCTGTTTGAGGGTGGATAGCA CTCAAACAGGTGAATTATTAGCACTTGTAAG CTATCCACCCTCAAACAGGTGAATTATTAGC CTAATAATTCACCTGTTTGAGGGTGGATAGC CCTCAAACAGGTGAATTATTAGCACTTGTAA CAGGTACTGCTATCCACCCTCAAACAGGTGA ATAATTTAAATGATATTGAAAGTGTATGCAT CAAGTGCTAATAATTCACCTGTTTGAGGGTG CAAACAGGTGAATTATTAGCACTTGTAAGCA ATCTTACAACTAATGAAACAGAAAGTCGTAA ATCCACCCTCAAACAGGTGAATTATTAGCAC AGTGCTAATAATTCACCTGTTTGAGGGTGGA AGGTACTGCTATCCACCCTCAAACAGGTGAA ACCTGTTTGAGGGTGGATAGCAGTACCTGAG CTTAAATCAGAATCAAGAAGTGCTCATTTCA ACAAGTGCTAATAATTCACCTGTTTGAGGGT AATTCACCTGTTTGAGGGTGGATAGCAGTAC AATAATTCACCTGTTTGAGGGTGGATAGCAG AAGTGCTAATAATTCACCTGTTTGAGGGTGG AACAGGTGAATTATTAGCACTTGTAAGCACA AAACAGGTGAATTATTAGCACTTGTAAGCAC TTAATTTTGTTAAAGAAGATGGTATGTGGAA TCCACATACCATCTTCTTTAACAAAATTAAA TAATAGAGAAAAAGAAAAAAGATGGCAAAGA AAATTTCTTACTGCCTAATTCGAGTGCTACT GTTCAATTTAATTTTGTTAAAGAAGATGGTA GCCATCTTTTTTCTTTTTCTCTATTAATGTA CTTTGCCATCTTTTTTCTTTTTCTCTATTAA CTTCCACATACCATCTTCTTTAACAAAATTA CATTAATAGAGAAAAAGAAAAAAGATGGCAA CATACCATCTTCTTTAACAAAATTAAATTGA AGAATTAAAACAAAAAGAATATAAAGGCTAT ATTAATAGAGAAAAAGAAAAAAGATGGCAAA ATAGAGAAAAAGAAAAAAGATGGCAAAGATA ATACCATCTTCTTTAACAAAATTAAATTGAA ATACATTAATAGAGAAAAAGAAAAAAGATGG ACGTTCAATTTAATTTTGTTAAAGAAGATGG ACCATCTTCTTTAACAAAATTAAATTGAACG ACATTAATAGAGAAAAAGAAAAAAGATGGCA ACATACCATCTTCTTTAACAAAATTAAATTG AATTTTGTTAAAGAAGATGGTATGTGGAAGT AATTTAATTTTGTTAAAGAAGATGGTATGTG AATAGAGAAAAAGAAAAAAGATGGCAAAGAT AACTGCATCATCTTTATAGCCTTTATATTCT TCCAGTAATACCTTTTAATTCTACATTTAAA TATGCATGCCAGATGCAATGATACCTTTAAA TAATCCTCTATGTCCATATACAGTTAGCATA TAATATGCTAACTGTATATGGACATAGAGGA TAAAGGTATCATTGCATCTGGCATGCATACA GTCCAGTAATACCTTTTAATTCTACATTTAA GTATGCATGCCAGATGCAATGATACCTTTAA GTAATACCTTTTAATTCTACATTTAAATTCA GGTCCAGTAATACCTTTTAATTCTACATTTA GGTAATCCTCTATGTCCATATACAGTTAGCA GGAGAGGTAATATGCTAACTGTATATGGACA GATTTTGGCATTGTAGCTAGCCATTCCTTTA GATTTAAAGGTATCATTGCATCTGGCATGCA GATAAAGGAATGGCTAGCTACAATGCCAAAA CTCTATGTCCATATACAGTTAGCATATTACC CTATGTCCATATACAGTTAGCATATTACCTC CTAGGTAATCCTCTATGTCCATATACAGTTA CTAACTGTATATGGACATAGAGGATTACCTA ATAAAAAATACGATATAGATGAATAACAAAA CCTCTATGTCCATATACAGTTAGCATATTAC CCATTCGGTCCAGTAATACCTTTTAATTCTA CATTCGGTCCAGTAATACCTTTTAATTCTAC CATGCCAGATGCAATGATACCTTTAAATCTA CATATACAGTTAGCATATTACCTCTCCTTGC CAGAACAAAGTAGATTTAAAGGTATCATTGC CAATGATACCTTTAAATCTACTTTGTTCTGC CAAGGAGAGGTAATATGCTAACTGTATATGG CAAAGTAGATTTAAAGGTATCATTGCATCTG ATTTAAATGTAGAATTAAAAGGTATTACTGG ATTCGGTCCAGTAATACCTTTTAATTCTACA ATGTCCATATACAGTTAGCATATTACCTCTC ATGTAGAATTAAAAGGTATTACTGGACCGAA ATGCTAACTGTATATGGACATAGAGGATTAC ATGCCAGATGCAATGATACCTTTAAATCTAC ATGCATGCCAGATGCAATGATACCTTTAAAT ATGCAATGATACCTTTAAATCTACTTTGTTC ATGCAAGGAGAGGTAATATGCTAACTGTATA ATGAATTTAAATGTAGAATTAAAAGGTATTA ATATACAGTTAGCATATTACCTCTCCTTGCA ATACCTTTTAATTCTACATTTAAATTCATAT ATAAAGGAATGGCTAGCTACAATGCCAAAAT CAAAATCTCAGGTAAAGTGTATGATGAGCTA AGTAGATTTAAAGGTATCATTGCATCTGGCA AGTAATACCTTTTAATTCTACATTTAAATTC AGGTAATCCTCTATGTCCATATACAGTTAGC AGGTAATATGCTAACTGTATATGGACATAGA AGGAGAGGTAATATGCTAACTGTATATGGAC AGATTTAAAGGTATCATTGCATCTGGCATGC AGATAAAGGAATGGCTAGCTACAATGCCAAA AGAGGTAATATGCTAACTGTATATGGACATA AGAATTAAAAGGTATTACTGGACCGAATGGA AGAACAAAGTAGATTTAAAGGTATCATTGCA ACAAAGTAGATTTAAAGGTATCATTGCATCT AATTTAAATGTAGAATTAAAAGGTATTACTG AATGTAGAATTAAAAGGTATTACTGGACCGA CTGGGTTAATCAGTATTTCACCTTGTCCGTA AATGCAAGGAGAGGTAATATGCTAACTGTAT AATATGCTAACTGTATATGGACATAGAGGAT GAGAAGTAACAGCACTTATTAATAATTCATA AATACCTTTTAATTCTACATTTAAATTCATA AAGTAGATTTAAAGGTATCATTGCATCTGGC AAGGTATCATTGCATCTGGCATGCATACACT AAGGAGAGGTAATATGCTAACTGTATATGGA AAGATAAAGGAATGGCTAGCTACAATGCCAA AACTGTATATGGACATAGAGGATTACCTAGT AACAAAGTAGATTTAAAGGTATCATTGCATC ACTTGTAAGCACACCTTCATATGACGTCTAT AAATGTAGAATTAAAAGGTATTACTGGACCG AAATGCAAGGAGAGGTAATATGCTAACTGTA AAAGTAGATTTAAAGGTATCATTGCATCTGG AAAGGTATCATTGCATCTGGCATGCATACAC AAAGGAATGGCTAGCTACAATGCCAAAATCT TTAATAATACTATTGATGCAATTGAAGATAA AGATAAAAATTTCAAACAAGTTTATAAAGAT TATTACAAATGTAGTATTTATGTCAAAATAA TAATAATACTATTGATGCAATTGAAGATAAA GCTTCAAAAGATAAAGAAATTAATAATACTA AAGTGGAACGAAGGTATCATCTTGTACCCAA GATAAAGAAATTAATAATACTATTGATGCAA CTTCAATTGCATCAATAGTATTATTAATTTC CATTATTTTGACATAAATACTACATTTGTAA CAATAGTATTATTAATTTCTTTATCTTTTGA CAAAAGATAAAGAAATTAATAATACTATTGA ATTTTTATCTTCAATTGCATCAATAGTATTA ATTTTGACATAAATACTACATTTGTAATATA ATTATAACATTATTTTGACATAAATACTACA ATTACAAATGTAGTATTTATGTCAAAATAAT ATTAATAATACTATTGATGCAATTGAAGATA ATGTAGTATTTATGTCAAAATAATGTTATAA ATATTACAAATGTAGTATTTATGTCAAAATA ATAATACTATTGATGCAATTGAAGATAAAAA ATAAAGAAATTAATAATACTATTGATGCAAT ATCAGTATTTCACCTTGTCCGTAACCTGAAT AGATAAAGAAATTAATAATACTATTGATGCA AGAAATTAATAATACTATTGATGCAATTGAA AATTGCATCAATAGTATTATTAATTTCTTTA AATTAATAATACTATTGATGCAATTGAAGAT AATGTAGTATTTATGTCAAAATAATGTTATA AATAGTATTATTAATTTCTTTATCTTTTGAA AATACTATTGATGCAATTGAAGATAAAAATT AATAATACTATTGATGCAATTGAAGATAAAA AAGATAAAGAAATTAATAATACTATTGATGC AAGAAATTAATAATACTATTGATGCAATTGA AACATTATTTTGACATAAATACTACATTTGT AAATTATAACATTATTTTGACATAAATACTA AAATTAATAATACTATTGATGCAATTGAAGA AAATGTAGTATTTATGTCAAAATAATGTTAT AAAGATAAAGAAATTAATAATACTATTGATG AAAGAAATTAATAATACTATTGATGCAATTG AAAAGATAAAGAAATTAATAATACTATTGAT AGATGAATATCATAAATAAAGAAGTCGATAG TGTTAATATTTTTTGAGTTGAACCTGGTGAA TCCAGATTACAACTTCACCAGGTTCAACTCA TACAACTTCACCAGGTTCAACTCAAAAAATA GTACGTTATCGCTGAAATTACAAATAAGAAA GATTACAACTTCACCAGGTTCAACTCAAAAA GAGTTGAACCTGGTGAAGTTGTAATCTGGAA CTTCACCAGGTTCAACTCAAAAAATATTAAC GATATAGTCTTCAGAAATACTTAGTTCTTTA CTGTTAATATTTTTTGAGTTGAACCTGGTGA AGTCTAGTTTTTCTGTACCCCTTATCTGCAA CCAGATTACAACTTCACCAGGTTCAACTCAA CACCAGGTTCAACTCAAAAAATATTAACAGC CAAGTTCCAGATTACAACTTCACCAGGTTCA ATTTTTTGAGTTGAACCTGGTGAAGTTGTAA CATCATTTAAAGCTGCTTCAGAAGTAGAAGG TATAACTGCTATCTTTATAAACTTGTTTGAA CTCTTTTTAATGGAAATAAAAGTGCGATTAA ATGCTTCAAAAGATAAAGAAATTAATAATAC AGTTGAACCTGGTGAAGTTGTAATCTGGAAC AGTTCCAGATTACAACTTCACCAGGTTCAAC AGTATTATTAATTTCTTTATCTTTTGAAGCA AGATTACAACTTCACCAGGTTCAACTCAAAA ACTTCACCAGGTTCAACTCAAAAAATATTAA ACAAGTTCCAGATTACAACTTCACCAGGTTC ACAACTTCACCAGGTTCAACTCAAAAAATAT AATATTTTTTGAGTTGAACCTGGTGAAGTTG AAGTTCCAGATTACAACTTCACCAGGTTCAA AACTTCACCAGGTTCAACTCAAAAAATATTA AACAAGTTCCAGATTACAACTTCACCAGGTT GTAAATACGGAGAAGAAGTTGTAGCAGGAAC TCCTTTCAATCTATAGCGCATTAGAAAATAA TCAATCTATAGCGCATTAGAAAATAATGGCA GCCATTATTTTCTAATGCGCTATAGATTGAA CCATTATTTTCTAATGCGCTATAGATTGAAA CATTATTTTCTAATGCGCTATAGATTGAAAG ATTATTTTCTAATGCGCTATAGATTGAAAGG ATCCTTTCAATCTATAGCGCATTAGAAAATA AATCTATAGCGCATTAGAAAATAATGGCAAT AAGCGACTTCACATCTATTAGGTTATGTTGG GACGATAAAACAAGTTATAAAATCGATGGTA AAGATGGTATGTGGAAGTTAGATTGGGATCA CTTTACCATCGATTTTATAACTTGTTTTATC CAGTAAGAAATTTGAAAAAGGCATGAAAAAA AGGCATCGTTCCAAAGAATGTATCTAAAAAA CGATAAAACAAGTTATAAAATCGATGGTAAA CCATCGATTTTATAACTTGTTTTATCGTCTA CATCGATTTTATAACTTGTTTTATCGTCTAA AGTTATAAAATCGATGGTAAAGGTTGGCAAA CAAGTTATAAAATCGATGGTAAAGGTTGGCA CAAAACATTAGACGATAAAACAAGTTATAAA ATCGATTTTATAACTTGTTTTATCGTCTAAT ATAACTTGTTTTATCGTCTAATGTTTTGTTA ATAAAACAAGTTATAAAATCGATGGTAAAGG ACGATAAAACAAGTTATAAAATCGATGGTAA ACCATCGATTTTATAACTTGTTTTATCGTCT ACATTAGACGATAAAACAAGTTATAAAATCG ACAAGTTATAAAATCGATGGTAAAGGTTGGC ACAAAACATTAGACGATAAAACAAGTTATAA AAGTTATAAAATCGATGGTAAAGGTTGGCAA AACATTAGACGATAAAACAAGTTATAAAATC AACAAGTTATAAAATCGATGGTAAAGGTTGG AACAAAACATTAGACGATAAAACAAGTTATA AAACATTAGACGATAAAACAAGTTATAAAAT AAACAAGTTATAAAATCGATGGTAAAGGTTG AAAACATTAGACGATAAAACAAGTTATAAAA AAAACAAGTTATAAAATCGATGGTAAAGGTT TAACATTTTCTTTGCTAGAGTAGCACTCGAA GTGCTACTCTAGCAAAGAAAATGTTATCTGA CTTGTTTCATTTTGAGTTCTGCAGTACCGGA CTCCTTGTTTCATTTTGAGTTCTGCAGTACC CTACTCTAGCAAAGAAAATGTTATCTGATGA CGGTACTGCAGAACTCAAAATGAAACAAGGA CGAGTGCTACTCTAGCAAAGAAAATGTTATC CCGGTACTGCAGAACTCAAAATGAAACAAGG CATCAGATAACATTTTCTTTGCTAGAGTAGC ATCATCAGATAACATTTTCTTTGCTAGAGTA ATCAGATAACATTTTCTTTGCTAGAGTAGCA ATAACATTTTCTTTGCTAGAGTAGCACTCGA AGTGCTACTCTAGCAAAGAAAATGTTATCTG AACATTTTCTTTGCTAGAGTAGCACTCGAAT TACGTTAATTAAAAAAATAAAAATGCAAGGA CCTTGCATTTTTATTTTTTTAATTAACGTAA ACGTTAATTAAAAAAATAAAAATGCAAGGAG TACCGTCACTGAAACGTAAGACTCACCTCTA TACAGATCCTTTCAATCTATAGCGCATTAGA TAAGTCTACCGTCACTGAAACGTAAGACTCA TAAGACTCACCTCTAACTTTCTATTGAGACA GTAAGACTCACCTCTAACTTTCTATTGAGAC GAGTCTTACGTTTCAGTGACGGTAGACTTAC GAGGTGAGTCTTACGTTTCAGTGACGGTAGA CTGAAACGTAAGACTCACCTCTAACTTTCTA CACCATTTTATCTGCATTGTCTGTAAAGATA CTAATGCGCTATAGATTGAAAGGATCTGTAC CGTAAGACTCACCTCTAACTTTCTATTGAGA AATGATACCTTTAAATCTACTTTGTTCTGCT CCGTCACTGAAACGTAAGACTCACCTCTAAC CCCAGTACAGATCCTTTCAATCTATAGCGCA CAGATCCTTTCAATCTATAGCGCATTAGAAA CACTGAAACGTAAGACTCACCTCTAACTTTC ATTTTCTAATGCGCTATAGATTGAAAGGATC ATGCGCTATAGATTGAAAGGATCTGTACTGG ATAGAAAGTTAGAGGTGAGTCTTACGTTTCA AGTCTACCGTCACTGAAACGTAAGACTCACC AGTACAGATCCTTTCAATCTATAGCGCATTA AGGTGAGTCTTACGTTTCAGTGACGGTAGAC AGATCCTTTCAATCTATAGCGCATTAGAAAA AGAGGTGAGTCTTACGTTTCAGTGACGGTAG ACTGAAACGTAAGACTCACCTCTAACTTTCT ACGTAAGACTCACCTCTAACTTTCTATTGAG ACCGTCACTGAAACGTAAGACTCACCTCTAA ACCCAGTACAGATCCTTTCAATCTATAGCGC ACAGATCCTTTCAATCTATAGCGCATTAGAA AATGCGCTATAGATTGAAAGGATCTGTACTG AATAGAAAGTTAGAGGTGAGTCTTACGTTTC AAGTTAGAGGTGAGTCTTACGTTTCAGTGAC AAGTCTACCGTCACTGAAACGTAAGACTCAC AAGACTCACCTCTAACTTTCTATTGAGACAA AACGTAAGACTCACCTCTAACTTTCTATTGA AAAGTTAGAGGTGAGTCTTACGTTTCAGTGA AAACGTAAGACTCACCTCTAACTTTCTATTG TGAGCAGAGGTTCTTTTTTATCTTCGGTTAA TAACCGAAGATAAAAAAGAACCTCTGCTCAA GATAAAAAAGAACCTCTGCTCAACAAGTTCC GAACCTCTGCTCAACAAGTTCCAGATTACAA CTGGAACTTGTTGAGCAGAGGTTCTTTTTTA CGAAGATAAAAAAGAACCTCTGCTCAACAAG CCGAAGATAAAAAAGAACCTCTGCTCAACAA CAGAGGTTCTTTTTTATCTTCGGTTAATTTA CTTTGTTCTGCTTTTTCTTTATCTATATGCA ATAAAAAAGAACCTCTGCTCAACAAGTTCCA AGATAAAAAAGAACCTCTGCTCAACAAGTTC AGAGGTTCTTTTTTATCTTCGGTTAATTTAT AGAACCTCTGCTCAACAAGTTCCAGATTACA ACTTGTTGAGCAGAGGTTCTTTTTTATCTTC ACCGAAGATAAAAAAGAACCTCTGCTCAACA GCCATAATCATTTTTCATGTTGTTATAAATA AACCTCTGCTCAACAAGTTCCAGATTACAAC AACCGAAGATAAAAAAGAACCTCTGCTCAAC AAATTAACCGAAGATAAAAAAGAACCTCTGC AAAGAACCTCTGCTCAACAAGTTCCAGATTA AAAAGAACCTCTGCTCAACAAGTTCCAGATT AAAAAGAACCTCTGCTCAACAAGTTCCAGAT AAAAAAGAACCTCTGCTCAACAAGTTCCAGA CCCCAAGATTTATCTTTTTGCCAACCTTTAC CCCAAGATTTATCTTTTTGCCAACCTTTACC CCAAGATTTATCTTTTTGCCAACCTTTACCA ATGGTAAAGGTTGGCAAAAAGATAAATCTTG GTATTTCATATATGTCTCTCTTTCTTATTCA ACCCCAAGATTTATCTTTTTGCCAACCTTTA AAGGTTGGCAAAAAGATAAATCTTGGGGTGG AAGATTTATCTTTTTGCCAACCTTTACCATC AAAGGTTGGCAAAAAGATAAATCTTGGGGTG TTATATTCTTCGTTACTCATGCCATACATAA TGTATGGCATGAGTAACGAAGAATATAATAA TATATTCTTCGTTACTCATGCCATACATAAA GAGGGTGGATAGCAGTACCTGAGCCATAATC CGTTATTCATTTGTGTTCCTGCTACAACTTC CATTTATGTATGGCATGAGTAACGAAGAATA ATTTATTATATTCTTCGTTACTCATGCCATA ATTCTTCGTTACTCATGCCATACATAAATGG ATGTATGGCATGAGTAACGAAGAATATAATA ATGATTATGGCTCAGGTACTGCTATCCACCC ATATTCTTCGTTACTCATGCCATACATAAAT AGGGTGGATAGCAGTACCTGAGCCATAATCA CGAGTCCCTTTTTACCAATAACTGCATCATC GGATCTGTACTGGGTTAATCAGTATTTCACC TTATAAATACTCTTTTGAACTTTAGCATCAA AATTAGGCAGTAAGAAATTTGAAAAAGGCAT TACGTTTCAGTGACGGTAGACTTACCTTTAA TAAAGGTAAGTCTACCGTCACTGAAACGTAA GTTGTTATAAATACTCTTTTGAACTTTAGCA GTTATAAATACTCTTTTGAACTTTAGCATCA GTGACGGTAGACTTACCTTTAACATGTTACA GTAGACTTACCTTTAACATGTTACATACTAA GGTAGACTTACCTTTAACATGTTACATACTA GCTAAAGTTCAAAAGAGTATTTATAACAACA GATGCTAAAGTTCAAAAGAGTATTTATAACA GACGGTAGACTTACCTTTAACATGTTACATA CTATTGATGCTAAAGTTCAAAAGAGTATTTA AACTGGTTGGAGTTAGATGTTGCAATTACAA GCAACAAGTCGTAAATAAAACACATAAAGAA CATGTTGTTATAAATACTCTTTTGAACTTTA CATGTTAAAGGTAAGTCTACCGTCACTGAAA CAGTGACGGTAGACTTACCTTTAACATGTTA ATTAGCTGATTCAGGTTACGGACAAGGTGAA TGATACCTTCGTTCCACTTAAAACCGTTAAA CGTTTCAGTGACGGTAGACTTACCTTTAACA ATTGATGCTAAAGTTCAAAAGAGTATTTATA ATGTTGTTATAAATACTCTTTTGAACTTTAG ATGTTAAAGGTAAGTCTACCGTCACTGAAAC ATGCTAAAGTTCAAAAGAGTATTTATAACAA TTCATGATGATTATTTAGAACGGACTACAAA ATAAATACTCTTTTGAACTTTAGCATCAATA AGTGACGGTAGACTTACCTTTAACATGTTAC AGTCTTACGTTTCAGTGACGGTAGACTTACC AGTATGTAACATGTTAAAGGTAAGTCTACCG AGGTAAGTCTACCGTCACTGAAACGTAAGAC GGTTCAACTCAAAAAATATTAACAGCAATGA ACGTTTCAGTGACGGTAGACTTACCTTTAAC ACGGTAGACTTACCTTTAACATGTTACATAC ACATGTTAAAGGTAAGTCTACCGTCACTGAA AAGGTAAGTCTACCGTCACTGAAACGTAAGA AACATGTTAAAGGTAAGTCTACCGTCACTGA AAATACTCTTTTGAACTTTAGCATCAATAGT AAAGGTAAGTCTACCGTCACTGAAACGTAAG CAACAAATGGATCAAAATTGGGTACAAGATG TGTTTTAATTCTTCAGAGTTAATGGGACCAA TGTTGGTCCCATTAACTCTGAAGAATTAAAA TGTATGCTTTGGTCTTTCTGCATTCCTGGAA TGGTCCCATTAACTCTGAAGAATTAAAACAA TGCAGAAAGACCAAAGCATACATATTGAAAA TCCCATTAACTCTGAAGAATTAAAACAAAAA TATTCTTTTTGTTTTAATTCTTCAGAGTTAA TATTAGGTTATGTTGGTCCCATTAACTCTGA TATGTTGGTCCCATTAACTCTGAAGAATTAA TATGCTTTGGTCTTTCTGCATTCCTGGAATA TAGGTTATGTTGGTCCCATTAACTCTGAAGA TAATTCTTCAGAGTTAATGGGACCAACATAA GTCCCATTAACTCTGAAGAATTAAAACAAAA GTCATTATTCCAGGAATGCAGAAAGACCAAA GGTCCCATTAACTCTGAAGAATTAAAACAAA GCGTCATTATTCCAGGAATGCAGAAAGACCA GCCTTTATATTCTTTTTGTTTTAATTCTTCA GATATTGAAAGTGTATGCATGCCAGATGCAA GAATGCAGAAAGACCAAAGCATACATATTGA GAAAGACCAAAGCATACATATTGAAAATTTA CTTTATATTCTTTTTGTTTTAATTCTTCAGA CTTCAGAGTTAATGGGACCAACATAACCTAA CTCTGAAGAATTAAAACAAAAAGAATATAAA CGTCATTATTCCAGGAATGCAGAAAGACCAA CCTTTATATTCTTTTTGTTTTAATTCTTCAG CCCATTAACTCTGAAGAATTAAAACAAAAAG CCATTAACTCTGAAGAATTAAAACAAAAAGA CCAGGAATGCAGAAAGACCAAAGCATACATA CATTATTCCAGGAATGCAGAAAGACCAAAGC CATTAACTCTGAAGAATTAAAACAAAAAGAA CAGAGTTAATGGGACCAACATAACCTAATAG CAATATGTATGCTTTGGTCTTTCTGCATTCC TGCAGGATCTTGGTTTGGTGAAAAATTCAAA ATTTTCAATATGTATGCTTTGGTCTTTCTGC ATTCTTCAGAGTTAATGGGACCAACATAACC ATTATTCCAGGAATGCAGAAAGACCAAAGCA ATTAGGTTATGTTGGTCCCATTAACTCTGAA ATTAACTCTGAAGAATTAAAACAAAAAGAAT ATGTTGGTCCCATTAACTCTGAAGAATTAAA ATGTATGCTTTGGTCTTTCTGCATTCCTGGA ATGCAGAAAGACCAAAGCATACATATTGAAA ATATTTATAGATCTTATGCAAACTTAATTGG ATATTCTTTTTGTTTTAATTCTTCAGAGTTA ATATGTATGCTTTGGTCTTTCTGCATTCCTG AGGTTATGTTGGTCCCATTAACTCTGAAGAA ACTCTGAAGAATTAAAACAAAAAGAATATAA AATACGATATAGATGAATAACAAAACAGTGA AATTTTCAATATGTATGCTTTGGTCTTTCTG AATTCTTCAGAGTTAATGGGACCAACATAAC AATGCAGAAAGACCAAAGCATACATATTGAA AATATGTATGCTTTGGTCTTTCTGCATTCCT AAGACCAAAGCATACATATTGAAAATTTAAA AATAGCAAATGAATATAATATGAATTTAAAT AACTCTGAAGAATTAAAACAAAAAGAATATA AAAGACCAAAGCATACATATTGAAAATTTAA CATTAATAGCCATCATCATGTTTGGATTATC TATCTAAAAATAAAAAACGAGTAGATGCTCA GATGTACAAGATAAAGGAATGGCTAGCTACA AATTGCATCATTTAAAGCTGCTTCAGAAGTA GAGCATCTACTCGTTTTTTATTTTTAGATAC GACACTGTAACGAGTCCATTTTCTTTTTTTA GAAAATGGACTCGTTACAGTGTCACTTTCAA CTGTAACGAGTCCATTTTCTTTTTTTATGGA CTAAAAATAAAAAACGAGTAGATGCTCAATA CACTGTAACGAGTCCATTTTCTTTTTTTATG GAAGAAGTTGTAGCAGGAACACAAATGAATA AAAAGTTGTTGCAAATTGGATAATTTCTTCT ATTGAGCATCTACTCGTTTTTTATTTTTAGA AGATAACATTTTCTTTGCTAGAGTAGCACTC ATGGACTCGTTACAGTGTCACTTTCAACATA ATCTAAAAATAAAAAACGAGTAGATGCTCAA ATCCATAAAAAAAGAAAATGGACTCGTTACA ATATTGAGCATCTACTCGTTTTTTATTTTTA ATAAAAAACGAGTAGATGCTCAATATAAAAT AATCAAGAAGTGCTCATTTCAAGCTTTAATG AGCATCTACTCGTTTTTTATTTTTAGATACT AGAAAATGGACTCGTTACAGTGTCACTTTCA ACTGTAACGAGTCCATTTTCTTTTTTTATGG ACTCGTTTTTTATTTTTAGATACTTTTTTTA ACACTGTAACGAGTCCATTTTCTTTTTTTAT AATGGACTCGTTACAGTGTCACTTTCAACAT AATCCATAAAAAAAGAAAATGGACTCGTTAC AAGTATCTAAAAATAAAAAACGAGTAGATGC AACGAGTCCATTTTCTTTTTTTATGGATTTC AACGAGTAGATGCTCAATATAAAATTAAAAC AAATGGACTCGTTACAGTGTCACTTTCAACA AAATCCATAAAAAAAGAAAATGGACTCGTTA AAATAAAAAACGAGTAGATGCTCAATATAAA AAAGTATCTAAAAATAAAAAACGAGTAGATG AAAGAAAATGGACTCGTTACAGTGTCACTTT AAACGAGTAGATGCTCAATATAAAATTAAAA AAAATGGACTCGTTACAGTGTCACTTTCAAC AAAATAAAAAACGAGTAGATGCTCAATATAA AAAAGTATCTAAAAATAAAAAACGAGTAGAT AAAAGAAAATGGACTCGTTACAGTGTCACTT AAAACGAGTAGATGCTCAATATAAAATTAAA AAAAATAAAAAACGAGTAGATGCTCAATATA AAAAAGTATCTAAAAATAAAAAACGAGTAGA AAAAAGAAAATGGACTCGTTACAGTGTCACT AAAAACGAGTAGATGCTCAATATAAAATTAA AAAAAAGTATCTAAAAATAAAAAACGAGTAG AAAAAAGAAAATGGACTCGTTACAGTGTCAC AAAAAACGAGTAGATGCTCAATATAAAATTA AAAAAAAGTATCTAAAAATAAAAAACGAGTA AAAAAAAGAAAATGGACTCGTTACAGTGTCA CAGTTACGTTAATTAAAAAAATAAAAATGCA AGTTACGTTAATTAAAAAAATAAAAATGCAA ACAGTTACGTTAATTAAAAAAATAAAAATGC TTACTGTAATGCTAAAATAGTAAACACTGAA TGCTAAAATAGTAAACACTGAAGATGCCAAA TATGGACTGTAAACAAACCAGCACGTGCAAA TAGTAAACACTGAAGATGCCAAACTTACTAA CATGATGATTATTTAGAACGGACTACAAATA GTGCTGGTTTGTTTACAGTCCATACGTTCAA AACAAGTCGTAAATAAAACACATAAAGAAGA GTATGGACTGTAAACAAACCAGCACGTGCAA GGTTTGCACGTGCTGGTTTGTTTACAGTCCA GGCATCTTCAGTGTTTACTATTTTAGCATTA GGACTGTAAACAAACCAGCACGTGCAAACCA GCTTTAGTAAGTTTGGCATCTTCAGTGTTTA GCATCTTCAGTGTTTACTATTTTAGCATTAC GCAAGTTGGTTTGCACGTGCTGGTTTGTTTA GACTGTAAACAAACCAGCACGTGCAAACCAA CTTTAGTAAGTTTGGCATCTTCAGTGTTTAC CTTCAGTGTTTACTATTTTAGCATTACAGTA CGTGCTGGTTTGTTTACAGTCCATACGTTCA CGTATGGACTGTAAACAAACCAGCACGTGCA AAAGATGCTTCTGCAGGATCTTGGTTTGGTG CATCTTCAGTGTTTACTATTTTAGCATTACA CAGTGTTTACTATTTTAGCATTACAGTAATC ATTCACCTGTTTGAGGGTGGATAGCAGTACC CAAGTTGGTTTGCACGTGCTGGTTTGTTTAC AAGAAAATGGACTCGTTACAGTGTCACTTTC ATTAGCAAGTTGGTTTGCACGTGCTGGTTTG ATTACTGTAATGCTAAAATAGTAAACACTGA ATGGACTGTAAACAAACCAGCACGTGCAAAC ATGCTAAAATAGTAAACACTGAAGATGCCAA ATCTTCAGTGTTTACTATTTTAGCATTACAG ATAGTAAACACTGAAGATGCCAAACTTACTA AGTTTGGCATCTTCAGTGTTTACTATTTTAG AGTAAACACTGAAGATGCCAAACTTACTAAA ACTGTAATGCTAAAATAGTAAACACTGAAGA ACTGTAAACAAACCAGCACGTGCAAACCAAC ACGTGCTGGTTTGTTTACAGTCCATACGTTC ACGTATGGACTGTAAACAAACCAGCACGTGC ACAAACCAGCACGTGCAAACCAACTTGCTAA AATTGAACGTATGGACTGTAAACAAACCAGC AATGCTAAAATAGTAAACACTGAAGATGCCA AATAGTAAACACTGAAGATGCCAAACTTACT AAGTTTGGCATCTTCAGTGTTTACTATTTTA AAGTTGGTTTGCACGTGCTGGTTTGTTTACA AACGTATGGACTGTAAACAAACCAGCACGTG AACCAGCACGTGCAAACCAACTTGCTAATTG AACACTGAAGATGCCAAACTTACTAAAGCAA AACAAACCAGCACGTGCAAACCAACTTGCTA AAATAGTAAACACTGAAGATGCCAAACTTAC AGTATTTCTGAAGACTATATCAAACAACAAA AAACCAGCACGTGCAAACCAACTTGCTAATT AAACACTGAAGATGCCAAACTTACTAAAGCA AAACAAACCAGCACGTGCAAACCAACTTGCT AAAATAGTAAACACTGAAGATGCCAAACTTA AGGTGAATTATTAGCACTTGTAAGCACACCT TTAATCTACGTCTCATCTCATTTTTAAAAAA TGGCTATTAATGTTAAAGATGTACAAGATAA TGATGATGGCTATTAATGTTAAAGATGTACA TCTTGTACATCTTTAACATTAATAGCCATCA TATTTTTACTACATCATCGAAAGTTGGCAAA TACTACATCATCGAAAGTTGGCAAATGTTCA GTTAATCTACGTCTCATCTCATTTTTAAAAA GGCTATTAATGTTAAAGATGTACAAGATAAA GGAGTTAATCTACGTCTCATCTCATTTTTAA GCTATTTTTACTACATCATCGAAAGTTGGCA GCCAACTTTCGATGATGTAGTAAAAATAGCA GTATGGCATGAGTAACGAAGAATATAATAAA GATGATGGCTATTAATGTTAAAGATGTACAA GAGTTAATCTACGTCTCATCTCATTTTTAAA CTTACTGCCTAATTCGAGTGCTACTCTAGCA GAACATTTGCCAACTTTCGATGATGTAGTAA CTATTTTTACTACATCATCGAAAGTTGGCAA CTACATCATCGAAAGTTGGCAAATGTTCATC GCCATCTTCATGTTGGAGCTTTTTATCGTAA CCAACTTTCGATGATGTAGTAAAAATAGCAA CATGATGATGGCTATTAATGTTAAAGATGTA ATAGTTACGACTTTCTGTTTCATTAGTTGTA ATTTTTTAAAAATGAGATGAGACGTAGATTA ATTTGCCAACTTTCGATGATGTAGTAAAAAT ATGGCTATTAATGTTAAAGATGTACAAGATA ATGATGGCTATTAATGTTAAAGATGTACAAG ATGATGATGGCTATTAATGTTAAAGATGTAC ATCTTGTACATCTTTAACATTAATAGCCATC AGTTAATCTACGTCTCATCTCATTTTTAAAA AGATGAACATTTGCCAACTTTCGATGATGTA ACTACATCATCGAAAGTTGGCAAATGTTCAT GGAGAACACTTTTAGATTACTGTAATGCTAA ACATTTGCCAACTTTCGATGATGTAGTAAAA ACATCTTTAACATTAATAGCCATCATCATGT ATATGCATATATTGAGGATCAAAAGTTGTTG AATCTACGTCTCATCTCATTTTTAAAAAATC AACATTTGCCAACTTTCGATGATGTAGTAAA ATGTTCATCTTTGAATTTTTCACCAAACCAA TTATGGCTCAGGTACTGCTATCCACCCTCAA TGGCTCAGGTACTGCTATCCACCCTCAAACA TATGGCTCAGGTACTGCTATCCACCCTCAAA CCTGTTTGAGGGTGGATAGCAGTACCTGAGC ATTATGGCTCAGGTACTGCTATCCACCCTCA ATGGCTCAGGTACTGCTATCCACCCTCAAAC GCTCAATATAAAATTAAAACAAACTACGGTA AATATGAAGGCTTTTTGTTTTGAATGTTTCT CAGATTACAACTTCACCAGGTTCAACTCAAA AGTTGGTTTGCACGTGCTGGTTTGTTTACAG ATCTTTACAGACAATGCAGATAAAATGGTGC ATAATCTTTTTTAGATACATTCTTTGGAACG GAGCCATAATCATTTTTCATGTTGTTATAAA ATATTGATGAAAAAGATAAAAATTGTTCCAC AGTGGAAGAACAATTAACAAACTTAAATCAG AGTGGAACAATTTTTATCTTTTTCATCAATA CTAGAGTAGCACTCGAATTAGGCAGTAAGAA TAGATTGAAAGGATCTGTACTGGGTTAATCA AGACTCACCTCTAACTTTCTATTGAGACAAA TAGAGTAGCACTCGAATTAGGCAGTAAGAAA ATAAAGGCTATAAAGATGATGCAGTTATTGG GATCGTAAAATAAAAAAAGTATCTAAAAATA TGGATAATCACTTGGTATATCTTCACCAACA AGTTTAACAAGCACAACATTAAAGCTTGAAA TAAAGATATAAACATTCAGGATCGTAAAATA GTTTGCATAAGATCTATAAATATCTTCTTTA GTTACAAGATATGAAGTGGTAAATGGTAATA GTTAAAGATATAAACATTCAGGATCGTAAAA GTGAAGATATACCAAGTGATTATCCATTTTA GGATAATCACTTGGTATATCTTCACCAACAC GCGTTAAAGATATAAACATTCAGGATCGTAA GATATTACCATTTACCACTTCATATCTTGTA GATAATCACTTGGTATATCTTCACCAACACC GAATATCTTTGCCATCTTTTTTCTTTTTCTC GAAGATATTTATAGATCTTATGCAAACTTAA GAAGATATACCAAGTGATTATCCATTTTATA GAAAAAGAAAAAAGATGGCAAAGATATTCAA TGATGGTATGCAACAAGTCGTAAATAAAACA CGTTAAAGATATAAACATTCAGGATCGTAAA ATAAAGATAATCCAAACATGATGATGGCTAT CACATAAAGAAGATATTTATAGATCTTATGC CAAGATATGAAGTGGTAAATGGTAATATCGA ATTTTACGATCCTGAATGTTTATATCTTTAA ATGGATAATCACTTGGTATATCTTCACCAAC ATATTACCATTTACCACTTCATATCTTGTAA CAAACAACAAATGGATCAAAATTGGGTACAA ATATCTTTGCCATCTTTTTTCTTTTTCTCTA AAAAATTTCAAACAAGTTTATAAAGATAGCA ATAAAGAAGATATTTATAGATCTTATGCAAA ATAAAATGGATAATCACTTGGTATATCTTCA AGAAGATATTTATAGATCTTATGCAAACTTA AGAAAAAGAAAAAAGATGGCAAAGATATTCA AGAAAAAAGATGGCAAAGATATTCAACTAAC ACATAAAGAAGATATTTATAGATCTTATGCA ACACATAAAGAAGATATTTATAGATCTTATG ACAAGATATGAAGTGGTAAATGGTAATATCG ACCATTTTATCTGCATTGTCTGTAAAGATAC AATGGATAATCACTTGGTATATCTTCACCAA TACGAATCTATCGACTTCTTTATTTATGATA AATATCTTTGCCATCTTTTTTCTTTTTCTCT AAGATATGAAGTGGTAAATGGTAATATCGAC AAGATATACCAAGTGATTATCCATTTTATAA AAGATATAAACATTCAGGATCGTAAAATAAA AAGAAGATATTTATAGATCTTATGCAAACTT AAGAAAAAAGATGGCAAAGATATTCAACTAA AAATGGATAATCACTTGGTATATCTTCACCA AAAATCTCAGGTAAAGTGTATGATGAGCTAT AAAGATATAAACATTCAGGATCGTAAAATAA AAAGAAGATATTTATAGATCTTATGCAAACT AAAGAAAAAAGATGGCAAAGATATTCAACTA AAAGATGTACAAGATAAAGGAATGGCTAGCT AAAATGGATAATCACTTGGTATATCTTCACC AGATCTTATGCAAACTTAATTGGCAAATCCG AAAAGAAAAAAGATGGCAAAGATATTCAACT AAAAAGATGGCAAAGATATTCAACTAACTAT AAAAAGAAAAAAGATGGCAAAGATATTCAAC AAAAAAGATGGCAAAGATATTCAACTAACTA GAAGGTGTGCTTACAAGTGCTAATAATTCAC AATTAAGTTTGCATAAGATCTATAAATATCT ACTGATTAACCCAGTACAGATCCTTTCAATC ATCATAGCGTCATTATTCCAGGAATGCAGAA TCATATGACGTCTATCCATTTATGTATGGCA AATTATGGGTAGAAGAAGGTAAATACGGAGA TAGCACTCGAATTAGGCAGTAAGAAATTTGA GAATTAAAACAAAAAGAATATAAAGGCTATA AGTTCAAAAGAGTATTTATAACAACATGAAA TGAATGATAATCAGTTGTTCATCTTTTGTAA TATTTACGACTTGTTGCATACCATCAGTTAA TATTAACTGATGGTATGCAACAAGTCGTAAA TATCAATCTATTAACTGATGGTATGCAACAA ACTCCATAATCAATACGAATCTATCGACTTC TAACTGATGGTATGCAACAAGTCGTAAATAA GTTGCAATTACAAAAGATGAACAACTGATTA ACGTGGTAAAATTTTAGACCGAAACAATGTG GCAATTACAAAAGATGAACAACTGATTATCA TAGACTTACCTTTAACATGTTACATACTAAA GATAATCAGTTGTTCATCTTTTGTAATTGCA GAAAATATCAATCTATTAACTGATGGTATGC CTATTAACTGATGGTATGCAACAAGTCGTAA CCAAAGAAAATATCAATCTATTAACTGATGG CATCAGTTAATAGATTGATATTTTCTTTGGA ATATTGTGGCATGATTTCTTCTGCAAGTTTA CAATCTATTAACTGATGGTATGCAACAAGTC CAACTGATTATCATTCATGATGATTATTTAG CAAAAGATGAACAACTGATTATCATTCATGA ATTACAAAAGATGAACAACTGATTATCATTC ATTAACTGATGGTATGCAACAAGTCGTAAAT ATGATAATCAGTTGTTCATCTTTTGTAATTG ATGAATGATAATCAGTTGTTCATCTTTTGTA ATGAACAACTGATTATCATTCATGATGATTA ATCAGTTGTTCATCTTTTGTAATTGCAACAT AAATTTTCAATATGTATGCTTTGGTCTTTCT ATCAGTTAATAGATTGATATTTTCTTTGGAA ATCAATCTATTAACTGATGGTATGCAACAAG ATATCAATCTATTAACTGATGGTATGCAACA ATAATCATCATGAATGATAATCAGTTGTTCA AGATGAACAACTGATTATCATTCATGATGAT AGAAAATATCAATCTATTAACTGATGGTATG ACTTGTTGCATACCATCAGTTAATAGATTGA CACCTGTTTGAGGGTGGATAGCAGTACCTGA ACGACTTGTTGCATACCATCAGTTAATAGAT ACCATCAGTTAATAGATTGATATTTTCTTTG ACAACTGATTATCATTCATGATGATTATTTA ACAAAAGATGAACAACTGATTATCATTCATG AATGATAATCAGTTGTTCATCTTTTGTAATT ACTGCTATCCACCCTCAAACAGGTGAATTAT AATCTATTAACTGATGGTATGCAACAAGTCG AATCATCATGAATGATAATCAGTTGTTCATC AATCAGTTGTTCATCTTTTGTAATTGCAACA AATATCAATCTATTAACTGATGGTATGCAAC AAGATGAACAACTGATTATCATTCATGATGA AAGAAAATATCAATCTATTAACTGATGGTAT AACTGATTATCATTCATGATGATTATTTAGA AACTGATGGTATGCAACAAGTCGTAAATAAA AAATATCAATCTATTAACTGATGGTATGCAA AAATAATCATCATGAATGATAATCAGTTGTT AAAGATGAACAACTGATTATCATTCATGATG AAAGAAAATATCAATCTATTAACTGATGGTA AAAATATCAATCTATTAACTGATGGTATGCA AAAAGATGAACAACTGATTATCATTCATGAT TAGATGCTCAATATAAAATTAAAACAAACTA GAGTAGATGCTCAATATAAAATTAAAACAAA CGAGTAGATGCTCAATATAAAATTAAAACAA AGTTTGTTTTAATTTTATATTGAGCATCTAC AGTAGATGCTCAATATAAAATTAAAACAAAC AGATGCTCAATATAAAATTAAAACAAACTAC GTTTTGTTATTTAACCCAATCATTGCTGTTA ATGGTATGCAACAAGTCGTAAATAAAACACA TATAAACATTCAGGATCGTAAAATAAAAAAA GATATAAACATTCAGGATCGTAAAATAAAAA ATATAAACATTCAGGATCGTAAAATAAAAAA ATAAACATTCAGGATCGTAAAATAAAAAAAG AGATATAAACATTCAGGATCGTAAAATAAAA ACTTTTTTTATTTTACGATCCTGAATGTTTA AACATTCAGGATCGTAAAATAAAAAAAGTAT AAACATTCAGGATCGTAAAATAAAAAAAGTA TCAGTTAATAGATTGATATTTTCTTTGGAAA TAATGGGACCAACATAACCTAATAGATGTGA TAATGAAACAGAAAGTCGTAACTATCCTCTA TAATAGATTGATATTTTCTTTGGAAATAATA GTTAATAGATTGATATTTTCTTTGGAAATAA GACTTCACATCTATTAGGTTATGTTGGTCCC CGACTTCACATCTATTAGGTTATGTTGGTCC CACATCTATTAGGTTATGTTGGTCCCATTAA CAACTAATGAAACAGAAAGTCGTAACTATCC ATTTCCAAAGAAAATATCAATCTATTAACTG ATTATTTCCAAAGAAAATATCAATCTATTAA ATGGGACCAACATAACCTAATAGATGTGAAG ATCTATTAGGTTATGTTGGTCCCATTAACTC AATAATCATCATGAATGATAATCAGTTGTTC AGTTAATGGGACCAACATAACCTAATAGATG AGTTAATAGATTGATATTTTCTTTGGAAATA AGAGGATAGTTACGACTTTCTGTTTCATTAG ACTTCACATCTATTAGGTTATGTTGGTCCCA ACTAATGAAACAGAAAGTCGTAACTATCCTC ACATCTATTAGGTTATGTTGGTCCCATTAAC ACAACTAATGAAACAGAAAGTCGTAACTATC AATGGGACCAACATAACCTAATAGATGTGAA AATGAAACAGAAAGTCGTAACTATCCTCTAG CCTTGTCCGTAACCTGAATCAGCTAATAATA CATCATAATTCAATTCAGTTATTTCCCCGGA AAAAACTTTACGATAAAAAGCTCCAACATGA AATAGATTGATATTTTCTTTGGAAATAATAT AACTAATGAAACAGAAAGTCGTAACTATCCT TAATTCTACATTTAAATTCATATTATATTCA ACCTTTACCATCGATTTTATAACTTGTTTTA ATGCATATAGATAAAGAAAAAGCAGAACAAA AATTAACCGAAGATAAAAAAGAACCTCTGCT GCCTTCATATTACAGAAGAAGAAATTATCCA GAATATAATATGAATTTAAATGTAGAATTAA CTTTTAATTCTACATTTAAATTCATATTATA CTACATTTAAATTCATATTATATTCATTTGC CCTTCATATTACAGAAGAAGAAATTATCCAA CAAATGAATATAATATGAATTTAAATGTAGA ATTGGATAATTTCTTCTTCTGTAATATGAAG TCCAAAGAATGTATCTAAAAAAGATTATAAA ATATAATATGAATTTAAATGTAGAATTAAAA TAATTTGAATAAGAAAGAGAGACATATATGA ATAGCAAATGAATATAATATGAATTTAAATG ATAATATGAATTTAAATGTAGAATTAAAAGG AGCCTTCATATTACAGAAGAAGAAATTATCC AGCAAATGAATATAATATGAATTTAAATGTA ACCTTTTAATTCTACATTTAAATTCATATTA ACATTTAAATTCATATTATATTCATTTGCTA AATTGGATAATTTCTTCTTCTGTAATATGAA AATTCTACATTTAAATTCATATTATATTCAT AATGAATATAATATGAATTTAAATGTAGAAT AATATGAATTTAAATGTAGAATTAAAAGGTA AATATAATATGAATTTAAATGTAGAATTAAA AAGATGGCAAAGATATTCAACTAACTATTGA AAATTGGATAATTTCTTCTTCTGTAATATGA AAATGAATATAATATGAATTTAAATGTAGAA TTATCTTTATCATATGATATAAACCACCCAA TGGCAAAAAGATAAATCTTGGGGTGGTTACA AGCTTTAAATGATGCAATTGTATTTTCCGGA ATAAGTGGAACAATTTTTATCTTTTTCATCA GTTGGCAAAAAGATAAATCTTGGGGTGGTTA GTAACCACCCCAAGATTTATCTTTTTGCCAA GGCAAAAAGATAAATCTTGGGGTGGTTACAA GGATTATCTTTATCATATGATATAAACCACC GCAGACAAATTGGGTGGTTTATATCATATGA GATTATCTTTATCATATGATATAAACCACCC GACAAATTGGGTGGTTTATATCATATGATAA CTTCAGAAGTAGAAGGTATAAACTGGTTGGA CTCCAACCAGTTTATACCTTCTACTTCTGAA CTAACTCCAACCAGTTTATACCTTCTACTTC AATCTATCGACTTCTTTATTTATGATATTCA CCAACCAGTTTATACCTTCTACTTCTGAAGC CATCTAACTCCAACCAGTTTATACCTTCTAC CATATGATATAAACCACCCAATTTGTCTGCC TGTACGTTATCGCTGAAATTACAAATAAGAA CAACCAGTTTATACCTTCTACTTCTGAAGCA CAAATTGGGTGGTTTATATCATATGATAAAG ATTGGGTGGTTTATATCATATGATAAAGATA ATTATCTTTATCATATGATATAAACCACCCA ATCATATGATATAAACCACCCAATTTGTCTG AGTAGAAGGTATAAACTGGTTGGAGTTAGAT AGATATGAAGTGGTAAATGGTAATATCGACT AGACAAATTGGGTGGTTTATATCATATGATA AGAAGTAGAAGGTATAAACTGGTTGGAGTTA ACTCCAACCAGTTTATACCTTCTACTTCTGA ACATCTAACTCCAACCAGTTTATACCTTCTA ACAAATTGGGTGGTTTATATCATATGATAAA AATTGGGTGGTTTATATCATATGATAAAGAT AAGTAGAAGGTATAAACTGGTTGGAGTTAGA AACTCCAACCAGTTTATACCTTCTACTTCTG AACCAGTTTATACCTTCTACTTCTGAAGCAG AAAGCGACTTCACATCTATTAGGTTATGTTG AACCACCCCAAGATTTATCTTTTTGCCAACC AACTACGGTAACATTGATCGCAACGTTCAAT AACACATAAAGAAGATATTTATAGATCTTAT TGGAGCTTGGGACATAAATGATTTTTTAAAA TGCTAATTGGGGAGTTGATGGTATCTTTACA TGAAGCATAAAAATATATACCAAACCCGACA TCGGGTTTGGTATATATTTTTATGCTTCAAA TCGAAAAACTTTACGATAAAAAGCTCCAACA TATACCAAACCCGACAACTACAACTATTAAA TAGTAAAGCTCCGGAAAATACAATTGCATCA TAGACTTGATTACAAAATGGAGCTTGGGACA TAATAGTTGTAGTTGTCGGGTTTGGTATATA TAAAAATATATACCAAACCCGACAACTACAA CATTAGACGATAAAACAAGTTATAAAATCGA GTGCAAACCAACTTGCTAATTGGGGAGTTGA GTCGGGTTTGGTATATATTTTTATGCTTCAA GTAAAGATACCATCAACTCCCCAATTAGCAA GGGAGTTGATGGTATCTTTACAGACAATGCA GGTGAAGTTGTAATCTGGAACTTGTTGAGCA GGATTACCTAGTAAAGCTCCGGAAAATACAA GGAGCTTGGGACATAAATGATTTTTTAAAAA GGACTCGAAAAACTTTACGATAAAAAGCTCC GCTTACAAGTGCTAATAATTCACCTGTTTGA GCATTGTCTGTAAAGATACCATCAACTCCCC GCATAAAAATATATACCAAACCCGACAACTA GCAATTGTATTTTCCGGAGCTTTACTAGGTA GATTACAAAATGGAGCTTGGGACATAAATGA GAGGATTACCTAGTAAAGCTCCGGAAAATAC GACTTGATTACAAAATGGAGCTTGGGACATA GACTCGAAAAACTTTACGATAAAAAGCTCCA GACATAGAGGATTACCTAGTAAAGCTCCGGA GAAGCATAAAAATATATACCAAACCCGACAA CTTGCTAATTGGGGAGTTGATGGTATCTTTA CTTGATTACAAAATGGAGCTTGGGACATAAA CTGTAAAGATACCATCAACTCCCCAATTAGC CTCGAAAAACTTTACGATAAAAAGCTCCAAC CTAGTAAAGCTCCGGAAAATACAATTGCATC CTAGACTTGATTACAAAATGGAGCTTGGGAC CTAATTGGGGAGTTGATGGTATCTTTACAGA CGGAGCTTTACTAGGTAATCCTCTATGTCCA CCGGAGCTTTACTAGGTAATCCTCTATGTCC CCAACTTGCTAATTGGGGAGTTGATGGTATC CCAAACCCGACAACTACAACTATTAAAATAA CATTTATGTCCCAAGCTCCATTTTGTAATCA CATTGTCTGTAAAGATACCATCAACTCCCCA CATGTTGGAGCTTTTTATCGTAAAGTTTTTC CATCAACTCCCCAATTAGCAAGTTGGTTTGC CATAGAGGATTACCTAGTAAAGCTCCGGAAA CAATTGTATTTTCCGGAGCTTTACTAGGTAA CAACTCCCCAATTAGCAAGTTGGTTTGCACG CAAACCCGACAACTACAACTATTAAAATAAG CAAACCAACTTGCTAATTGGGGAGTTGATGG ATTTTCCGGAGCTTTACTAGGTAATCCTCTA ATTTTAATAGTTGTAGTTGTCGGGTTTGGTA ATTTATGTCCCAAGCTCCATTTTGTAATCAA ATTGTCTGTAAAGATACCATCAACTCCCCAA ATTGTATTTTCCGGAGCTTTACTAGGTAATC ATTGGGGAGTTGATGGTATCTTTACAGACAA ATGTTGGAGCTTTTTATCGTAAAGTTTTTCG ATGGAGCTTGGGACATAAATGATTTTTTAAA ATGCAATTGTATTTTCCGGAGCTTTACTAGG ATGAGATAGGCATCGTTCCAAAGAATGTATC ATCATTTATGTCCCAAGCTCCATTTTGTAAT ATATACCAAACCCGACAACTACAACTATTAA ATAGAGGATTACCTAGTAAAGCTCCGGAAAA ATACCAAACCCGACAACTACAACTATTAAAA ATAAAAATATATACCAAACCCGACAACTACA AGTAAAGCTCCGGAAAATACAATTGCATCAT TCTTCCAAACTTTGTTTTTCGTGTCTTTTAA AGGATTACCTAGTAAAGCTCCGGAAAATACA AGCATAAAAATATATACCAAACCCGACAACT AGATACCATCAACTCCCCAATTAGCAAGTTG AGAGGATTACCTAGTAAAGCTCCGGAAAATA AGACTTGATTACAAAATGGAGCTTGGGACAT ACTTGATTACAAAATGGAGCTTGGGACATAA ACTCGAAAAACTTTACGATAAAAAGCTCCAA ACTAGACTTGATTACAAAATGGAGCTTGGGA ACCTAGTAAAGCTCCGGAAAATACAATTGCA ACCAACTTGCTAATTGGGGAGTTGATGGTAT ACCAAACCCGACAACTACAACTATTAAAATA ACATAGAGGATTACCTAGTAAAGCTCCGGAA AATTGTATTTTCCGGAGCTTTACTAGGTAAT AATTGGGGAGTTGATGGTATCTTTACAGACA ATGATTATTTAGAACGGACTACAAATATGTC AATGGAGCTTGGGACATAAATGATTTTTTAA AATGATGCAATTGTATTTTCCGGAGCTTTAC AATCATTTATGTCCCAAGCTCCATTTTGTAA AATATATACCAAACCCGACAACTACAACTAT AATAGTTGTAGTTGTCGGGTTTGGTATATAT AAGCTCCGGAAAATACAATTGCATCATTTAA AAGCATAAAAATATATACCAAACCCGACAAC AACTTGCTAATTGGGGAGTTGATGGTATCTT AACTCCCCAATTAGCAAGTTGGTTTGCACGT AACCCGACAACTACAACTATTAAAATAAGTG AAATGGAGCTTGGGACATAAATGATTTTTTA AAATGATGCAATTGTATTTTCCGGAGCTTTA AAATCATTTATGTCCCAAGCTCCATTTTGTA AAATATATACCAAACCCGACAACTACAACTA AAAGCTCCGGAAAATACAATTGCATCATTTA AAAGATACCATCAACTCCCCAATTAGCAAGT AAACCCGACAACTACAACTATTAAAATAAGT AAACCAACTTGCTAATTGGGGAGTTGATGGT AAAATCATTTATGTCCCAAGCTCCATTTTGT AAAATATATACCAAACCCGACAACTACAACT AAAAATATATACCAAACCCGACAACTACAAC AAAAAATCATTTATGTCCCAAGCTCCATTTT ATATCGTATTTTTTATTACCGTTCTCATATA AATAATTCATAATAAAACAGTGAAGCAACCA TTATGAATTGAACGTATGGACTGTAAACAAA TGAATTGAACGTATGGACTGTAAACAAACCA ATTATGATGAAATTAAAGATGCTTCTGCAGG TACAATGTATTACCTGGGTATACAGGTTTAA GTTTGTTTACAGTCCATACGTTCAATTCATA GTTATGAATTGAACGTATGGACTGTAAACAA GTACAATGTATTACCTGGGTATACAGGTTTA GGTTATGAATTGAACGTATGGACTGTAAACA TCAATATATGCATATAGATAAAGAAAAAGCA CTGGTTTGTTTACAGTCCATACGTTCAATTC CGGGTTATGAATTGAACGTATGGACTGTAAA CAATGTATTACCTGGGTATACAGGTTTAATA ACAACTTCTTCTCCGTATTTACCTTCTTCTA AAGAACCTCTGCTCAACAAGTTCCAGATTAC ATGTATTACCTGGGTATACAGGTTTAATAAA ATGAATTGAACGTATGGACTGTAAACAAACC GTCTCTCTTTCTTATTCAAATTAATTTTTTA GGGTTATGAATTGAACGTATGGACTGTAAAC AACTATTAAAATAAGTGGAACAATTTTTATC CATAAAAATATATACCAAACCCGACAACTAC ACAATGTATTACCTGGGTATACAGGTTTAAT AATGTATTACCTGGGTATACAGGTTTAATAA AACCTGTATACCCAGGTAATACATTGTACGT GAAGATGCCAAACTTACTAAAGCAAAAGTAA AAACCTGTATACCCAGGTAATACATTGTACG TGTTTGAAATTTTTATCTTCAATTGCATCAA TGATGCAATTGAAGATAAAAATTTCAAACAA CACCTCACTTATTAAAAGACACGAAAAACAA TATTGATGCAATTGAAGATAAAAATTTCAAA AACTTGTTGAGCAGAGGTTCTTTTTTATCTT GCAGATAAAATGGTGCATTTGTCTCAATAGA GACAATGCAGATAAAATGGTGCATTTGTCTC CTTTCTATTGAGACAAATGCACCATTTTATC CTTGTTTGAAATTTTTATCTTCAATTGCATC CTATTGATGCAATTGAAGATAAAAATTTCAA CTATTGAGACAAATGCACCATTTTATCTGCA AAAGCTTGAAATGAGCACTTCTTGATTCTGA CAGATAAAATGGTGCATTTGTCTCAATAGAA CAGACAATGCAGATAAAATGGTGCATTTGTC CAATGCAGATAAAATGGTGCATTTGTCTCAA CAAATGCACCATTTTATCTGCATTGTCTGTA ATTGATGCAATTGAAGATAAAAATTTCAAAC ATGCAGATAAAATGGTGCATTTGTCTCAATA CCTGGTGAAGTTGTAATCTGGAACTTGTTGA AGATAAAATGGTGCATTTGTCTCAATAGAAA TAATTTATTATATTCTTCGTTACTCATGCCA AGACAAATGCACCATTTTATCTGCATTGTCT ACTTTCTATTGAGACAAATGCACCATTTTAT ACTTGTTTGAAATTTTTATCTTCAATTGCAT ACTATTGATGCAATTGAAGATAAAAATTTCA ACAATGCAGATAAAATGGTGCATTTGTCTCA CAAATGAATAACGTTAAATTTATTAAACCTG TCTTCACGAAACGAAGTTGTATGGAATATAA ACAAATGCACCATTTTATCTGCATTGTCTGT ACAGAAGAAGAAATTATCCAATTTGCAACAA AATGCAGATAAAATGGTGCATTTGTCTCAAT AATGCACCATTTTATCTGCATTGTCTGTAAA AACTTGTTTGAAATTTTTATCTTCAATTGCA ATAAATATCTTCTTTATGTGTTTTATTTACG AAATGCACCATTTTATCTGCATTGTCTGTAA AAAATGGTGCATTTGTCTCAATAGAAAGTTA TGTTATCTGATGATTCTATTGCTTGTTTTAA TTAAGGGAGAAGTAACAGCACTTATTAATAA TACGATGATTTTATAGTAGGAGAAACATTCA ACATTATTTTGACATAAATACTACATTTGTA ACCACCCCAAGATTTATCTTTTTGCCAACCT GATGATTTTATAGTAGGAGAAACATTCAAAA AAAGATGAACATTTGCCAACTTTCGATGATG GATAAAAATTTCAAACAAGTTTATAAAGATA GACTTAAAACAAGCAATAGAATCATCAGATA TCACTTTCAACATACAATGAAAATGAAGAAA CTTCAGAAATACTTAGTTCTTTAGCGATTGC CTTAAAACAAGCAATAGAATCATCAGATAAC CTGATTATCATTCATGATGATTATTTAGAAC CTCTAGCAAAGAAAATGTTATCTGATGATTC CTAGCAAAGAAAATGTTATCTGATGATTCTA CGTTCTAAATAATCATCATGAATGATAATCA CGATGATTTTATAGTAGGAGAAACATTCAAA CCGTTCTAAATAATCATCATGAATGATAATC CAATCGCTAAAGAACTAAGTATTTCTGAAGA CAATAGAATCATCAGATAACATTTTCTTTGC CAAAGAAAATGTTATCTGATGATTCTATTGC ATTGAACGTATGGACTGTAAACAAACCAGCA ATGTTATCTGATGATTCTATTGCTTGTTTTA ATCTGATGATTCTATTGCTTGTTTTAAGTCG ATAGAATCATCAGATAACATTTTCTTTGCTA ATACGATGATTTTATAGTAGGAGAAACATTC AACAAGTTTATAAAGATAGCAGTTATATTTC ATAAAGCAATCGCTAAAGAACTAAGTATTTC AGTCTTCAGAAATACTTAGTTCTTTAGCGAT AGCAATCGCTAAAGAACTAAGTATTTCTGAA AGAATCATCAGATAACATTTTCTTTGCTAGA AGAAATACTTAGTTCTTTAGCGATTGCTTTA AGAAAATGTTATCTGATGATTCTATTGCTTG ACTTAAAACAAGCAATAGAATCATCAGATAA ACGATGATTTTATAGTAGGAGAAACATTCAA ACAAGCAATAGAATCATCAGATAACATTTTC AATCATCGTATTTCATATATGTCTCTCTTTC AATCGCTAAAGAACTAAGTATTTCTGAAGAC AATCATCAGATAACATTTTCTTTGCTAGAGT AATAGAATCATCAGATAACATTTTCTTTGCT AATACTTAGTTCTTTAGCGATTGCTTTATAA AAGCAATCGCTAAAGAACTAAGTATTTCTGA AAGAAAATGTTATCTGATGATTCTATTGCTT AAATACTTAGTTCTTTAGCGATTGCTTTATA AAAGCAATCGCTAAAGAACTAAGTATTTCTG AAAGAAAATGTTATCTGATGATTCTATTGCT AAACAAGCAATAGAATCATCAGATAACATTT AAAATGTTATCTGATGATTCTATTGCTTGTT AAAACAAGCAATAGAATCATCAGATAACATT CAATACAGGAACAGCATATGAGATAGGCATC AGCCATCATCATGTTTGGATTATCTTTATCA ATTAACCGAAGATAAAAAAGAACCTCTGCTC AAGATATTTATAGATCTTATGCAAACTTAAT CCATCTTCATGTTGGAGCTTTTTATCGTAAA TCCATTTATGTATGGCATGAGTAACGAAGAA AACTTTCTATTGAGACAAATGCACCATTTTA GAAATTTTTATCTTCAATTGCATCAATAGTA GAACTTTAGCATCAATAGTTAGTTGAATATC AATAAAAAACGAGTAGATGCTCAATATAAAA ACAGAAAAACTAGACTTGATTACAAAATGGA ACAACAAATGGATCAAAATTGGGTACAAGAT TCTACACCTCCATATCACAAAAATTATAACA TCACAAAAATTATAACATTATTTTGACATAA GTTATAATTTTTGTGATATGGAGGTGTAGAA GAGTTAGATGTTGCAATTACAAAAGATGAAC CTTCTACACCTCCATATCACAAAAATTATAA ATGCAGTTATTGGTAAAAAGGGACTCGAAAA CCTTCTACACCTCCATATCACAAAAATTATA CCATATCACAAAAATTATAACATTATTTTGA AGTTTATAAAGATAGCAGTTATATTTCTAAA CATATCACAAAAATTATAACATTATTTTGAC CACAAAAATTATAACATTATTTTGACATAAA CAAAATAATGTTATAATTTTTGTGATATGGA CAAAAATTATAACATTATTTTGACATAAATA ATGTTATAATTTTTGTGATATGGAGGTGTAG ATGTCAAAATAATGTTATAATTTTTGTGATA TGGTTTATATCATATGATAAAGATAATCCAA ATCACAAAAATTATAACATTATTTTGACATA ATATCACAAAAATTATAACATTATTTTGACA GGCGTTAAAGATATAAACATTCAGGATCGTA ACACCTCCATATCACAAAAATTATAACATTA ACAAAAATTATAACATTATTTTGACATAAAT AATGTTATAATTTTTGTGATATGGAGGTGTA AATAATGTTATAATTTTTGTGATATGGAGGT ACTTTTATTTCCATTAAAAAGAGATGAATAT AAATAATGTTATAATTTTTGTGATATGGAGG AAAATTATAACATTATTTTGACATAAATACT AAAATAATGTTATAATTTTTGTGATATGGAG AAAAATTATAACATTATTTTGACATAAATAC ATAATCAGTTGTTCATCTTTTGTAATTGCAA AATCGTTGACGATAATAGCAATACAATCGCA CTTTGGTCTTTCTGCATTCCTGGAATAATGA AAACTACGGTAACATTGATCGCAACGTTCAA AGGATCGTAAAATAAAAAAAGTATCTAAAAA CTTGAAATGAGCACTTCTTGATTCTGATTTA GTTCTGCTTTTTCTTTATCTATATGCATATA AACCAACTTGCTAATTGGGGAGTTGATGGTA AATAGTTTAGGCGTTAAAGATATAAACATTC ATTGCAGATAAGGGGTACAGAAAAACTAGAC CAAGATAAAGGAATGGCTAGCTACAATGCCA ACAATTGCATCATTTAAAGCTGCTTCAGAAG AATTATAACATTATTTTGACATAAATACTAC TTGGCCAATTCCACATTGTTTCGGTCTAAAA TGGTAAAATTTTAGACCGAAACAATGTGGAA TATTGGCCAATTCCACATTGTTTCGGTCTAA ATTATCATTCATGATGATTATTTAGAACGGA AAATTGAACGTTGCGATCAATGTTACCGTAG GTGGTAAAATTTTAGACCGAAACAATGTGGA GTATTGGCCAATTCCACATTGTTTCGGTCTA GGTAAAAGAAGCGGGTTATGAATTGAACGTA GCGGGTTATGAATTGAACGTATGGACTGTAA ATAGTATTATTAATTTCTTTATCTTTTGAAG GTTGGTCCCATTAACTCTGAAGAATTAAAAC CCACATTGTTTCGGTCTAAAATTTTACCACG CAGTCCATACGTTCAATTCATAACCCGCTTC CAATTCCACATTGTTTCGGTCTAAAATTTTA AAAGGGACTCGAAAAACTTTACGATAAAAAG CAAAAGTAAAAATGGTAAAAGAAGCGGGTTA ATTTTAGACCGAAACAATGTGGAATTGGCCA ATTGGCCAATTCCACATTGTTTCGGTCTAAA ATTCCACATTGTTTCGGTCTAAAATTTTACC ATTCATAACCCGCTTCTTTTACCATTTTTAC ATGGTAAAAGAAGCGGGTTATGAATTGAACG ATACGTTCAATTCATAACCCGCTTCTTTTAC AGTAAAAATGGTAAAAGAAGCGGGTTATGAA AGCGGGTTATGAATTGAACGTATGGACTGTA AGACCGAAACAATGTGGAATTGGCCAATACA AGAAGCGGGTTATGAATTGAACGTATGGACT ACGTTCAATTCATAACCCGCTTCTTTTACCA AATTTTAGACCGAAACAATGTGGAATTGGCC AATTCCACATTGTTTCGGTCTAAAATTTTAC AATTCATAACCCGCTTCTTTTACCATTTTTA AATGGTAAAAGAAGCGGGTTATGAATTGAAC TGCCTAATTCGAGTGCTACTCTAGCAAAGAA AAGTAAAAATGGTAAAAGAAGCGGGTTATGA AAGCGGGTTATGAATTGAACGTATGGACTGT AAGAAGCGGGTTATGAATTGAACGTATGGAC AACCCGCTTCTTTTACCATTTTTACTTTTGC AAATTTTAGACCGAAACAATGTGGAATTGGC AAAGTAAAAATGGTAAAAGAAGCGGGTTATG AAAGAAGCGGGTTATGAATTGAACGTATGGA AAAATTTTAGACCGAAACAATGTGGAATTGG AAAATGGTAAAAGAAGCGGGTTATGAATTGA AAAAGTAAAAATGGTAAAAGAAGCGGGTTAT AAAAGAAGCGGGTTATGAATTGAACGTATGG AAAAATGGTAAAAGAAGCGGGTTATGAATTG ATTTAATTTTGTTAAAGAAGATGGTATGTGG CTCCAGTCTTCACGAAACGAAGTTGTATGGA ACTATTAAAATAAGTGGAACAATTTTTATCT ATAATGTTATAATTTTTGTGATATGGAGGTG CCAACATGAAGATGGCTATCGTGTCACAATC CATACGTTCAATTCATAACCCGCTTCTTTTA GGCTATAAAGATGATGCAGTTATTGGTAAAA AGCCTTTATATTCTTTTTGTTTTAATTCTTC ATTTATAGATCTTATGCAAACTTAATTGGCA TCCAAACTTTGTTTTTCGTGTCTTTTAATAA AATTAATTTGAATAAGAAAGAGAGACATATA ATCTTGGTTTGGTGAAAAATTCAAAGATGAA CGTCTATCCATTTATGTATGGCATGAGTAAC ATAAAAATTGTTCCACTTATTTTAATAGTTG ATACCAAGTGATTATCCATTTTATAATGCTC ATCAACTCCCCAATTAGCAAGTTGGTTTGCA TAAAATAAAAAAAGTATCTAAAAATAAAAAA AAAAATTCAAAGATGAACATTTGCCAACTTT AAATGGTAAAAGAAGCGGGTTATGAATTGAA GTAACAGCACTTATTAATAATTCATAATAAA ATGTATCTAAAAAAGATTATAAAGCAATCGC AAGTGGAAGAACAATTAACAAACTTAAATCA TGAAATTTGAGCATTATAAAATGGATAATCA TCCATTTTATAATGCTCAAATTTCAAACAAA TATCCATTTTATAATGCTCAAATTTCAAACA AACAGCAATGATTGGGTTAAATAACAAAACA TAAATTTTTGTTTGAAATTTGAGCATTATAA GTTTGAAATTTGAGCATTATAAAATGGATAA GATTATCCATTTTATAATGCTCAAATTTCAA CCCTCAAACAGGTGAATTATTAGCACTTGTA GAAATTTGAGCATTATAAAATGGATAATCAC CTCTGCTCAACAAGTTCCAGATTACAACTTC CATCTTTGAATTTTTCACCAAACCAAGATCC CTAAATTTTTGTTTGAAATTTGAGCATTATA CCATTTTATAATGCTCAAATTTCAAACAAAA CATTTTATAATGCTCAAATTTCAAACAAAAA GTGGTTTATATCATATGATAAAGATAATCCA ATTTTATAATGCTCAAATTTCAAACAAAAAT ATTATCCATTTTATAATGCTCAAATTTCAAA ATCTAAATTTTTGTTTGAAATTTGAGCATTA ATCCATTTTATAATGCTCAAATTTCAAACAA ATAATGCTCAAATTTCAAACAAAAATTTAGA ATTCCAGGAATGCAGAAAGACCAAAGCATAC AAATAAAAAAAGTATCTAAAAATAAAAAACG ACCTCTGCTCAACAAGTTCCAGATTACAACT AATTTTTGTTTGAAATTTGAGCATTATAAAA AATGCTCAAATTTCAAACAAAAATTTAGATA AAGTTGTAATCTGGAACTTGTTGAGCAGAGG AAAAATCATTTATGTCCCAAGCTCCATTTTG AAATTTTTGTTTGAAATTTGAGCATTATAAA TGAAGAAATTGTATTTAAGGGAGAAGTAACA TGAAAATGAAGAAATTGTATTTAAGGGAGAA AAACTTGTTTGAAATTTTTATCTTCAATTGC ACAACTTTTGATCCTCAATATATGCATATAG TGCTTCTGCAGGATCTTGGTTTGGTGAAAAA GTTGCGATCAATGTTACCGTAGTTTGTTTTA GTTCTTTTTTATCTTCGGTTAATTTATTATA CTTCTCCCTTAAATACAATTTCTTCATTTTC CTGTTACTTCTCCCTTAAATACAATTTCTTC AAGATAGCAGTTATATTTCTAAAAGCGATAA AAGTTTGTTAATTGTTCTTCCACTTGCTTAA CAATCTATAGCGCATTAGAAAATAATGGCAA ATGAAGAAATTGTATTTAAGGGAGAAGTAAC ATGAAAATGAAGAAATTGTATTTAAGGGAGA CATTTGCCAACTTTCGATGATGTAGTAAAAA CTGCAGAACTCAAAATGAAACAAGGAGAAAC AATGAAGAAATTGTATTTAAGGGAGAAGTAA AATGAAAATGAAGAAATTGTATTTAAGGGAG AAGAAATTGTATTTAAGGGAGAAGTAACAGC AAATGAAGAAATTGTATTTAAGGGAGAAGTA AACATTCAAAACAAAAAGCCTTCATATTACA ATTTTTTATTACCGTTCTCATATAGCTCATC AAAATGAAGAAATTGTATTTAAGGGAGAAGT TAATAGCAATACAATCGCACATACATTAATA TCCTGCAGAAGCATCTTTAATTTCATCATAA AAAAGCGACTTCACATCTATTAGGTTATGTT AGTTAGTTGAATATCTTTGCCATCTTTTTTC GATTTATCTTTTTGCCAACCTTTACCATCGA AATTCGAGTGCTACTCTAGCAAAGAAAATGT CACCTTCTACACCTCCATATCACAAAAATTA ATCGATGGTAAAGGTTGGCAAAAAGATAAAT AGATTTATCTTTTTGCCAACCTTTACCATCG ACCTTCTACACCTCCATATCACAAAAATTAT CTCATATGCTGTTCCTGTATTGGCCAATTCC AATTTTTGTGATATGGAGGTGTAGAAGGTGT TTCTAAAAGTATGGTTAAGCAAGTGGAAGAA TCTTCCACTTGCTTAACCATACTTTTAGAAA ATGCTTTGGTCTTTCTGCATTCCTGGAATAA TATGGTTAAGCAAGTGGAAGAACAATTAACA CAAATTTCTTACTGCCTAATTCGAGTGCTAC TAAAAGTATGGTTAAGCAAGTGGAAGAACAA GTTCTTCCACTTGCTTAACCATACTTTTAGA GTATGGTTAAGCAAGTGGAAGAACAATTAAC GTAAAAAGGGACTCGAAAAACTTTACGATAA AAAGAGAGACATATATGAAATACGATGATTT TCATATGCTGTTCCTGTATTGGCCAATTCCA TACGACTTGTTGCATACCATCAGTTAATAGA CTTCCACTTGCTTAACCATACTTTTAGAAAG CTAAAAGTATGGTTAAGCAAGTGGAAGAACA CCACTTGCTTAACCATACTTTTAGAAAGTGC GTTTGGAAGAAAAATATTATTTCCAAAGAAA CACTTTCTAAAAGTATGGTTAAGCAAGTGGA TTACAAATAAGAAATCCATAAAAAAAGAAAA AGTATGGTTAAGCAAGTGGAAGAACAATTAA AGCACTTTCTAAAAGTATGGTTAAGCAAGTG TAAAAGACACGAAAAACAAAGTTTGGAAGAA ACTTTCTAAAAGTATGGTTAAGCAAGTGGAA ACTTGCTTAACCATACTTTTAGAAAGTGCTA AAGTATGGTTAAGCAAGTGGAAGAACAATTA ATGAGCACTTCTTGATTCTGATTTAAGTTTG AAAGTATGGTTAAGCAAGTGGAAGAACAATT TACAATTGCATCATTTAAAGCTGCTTCAGAA AAAAGTATGGTTAAGCAAGTGGAAGAACAAT ATTTATTAAACCTGTATACCCAGGTAATACA TCTCATTTTTAAAAAATCATTTATGTCCCAA CTGAAATTACAAATAAGAAATCCATAAAAAA GGACATAAATGATTTTTTAAAAATGAGATGA GCTTGGGACATAAATGATTTTTTAAAAATGA AAATGAGATGAGACGTAGATTAACTCCATAA GAAAAATGATTATGGCTCAGGTACTGCTATC GAAGACTATATCAAACAACAAATGGATCAAA CTCATTTTTAAAAAATCATTTATGTCCCAAG CTCATCTCATTTTTAAAAAATCATTTATGTC CTAATGTTTTGTTATTTAACCCAATCATTGC AATTAAAAAAATAAAAATGCAAGGAGAGGTA CATCTCATTTTTAAAAAATCATTTATGTCCC CATAAATGATTTTTTAAAAATGAGATGAGAC CAATGATTGGGTTAAATAACAAAACATTAGA ATTTTTAAAAAATCATTTATGTCCCAAGCTC ATGAAAAATGATTATGGCTCAGGTACTGCTA ATCTCATTTTTAAAAAATCATTTATGTCCCA ATAGCAGTACCTGAGCCATAATCATTTTTCA ATAAATGATTTTTTAAAAATGAGATGAGACG AGCTTGGGACATAAATGATTTTTTAAAAATG CTGTTTGAGGGTGGATAGCAGTACCTGAGCC AGCAGTACCTGAGCCATAATCATTTTTCATG AGCAATGATTGGGTTAAATAACAAAACATTA ACGTCTCATCTCATTTTTAAAAAATCATTTA AAATAACAAAACATTAGACGATAAAACAAGT ACATGAAAAATGATTATGGCTCAGGTACTGC ACATAAATGATTTTTTAAAAATGAGATGAGA ACAGCAATGATTGGGTTAAATAACAAAACAT AATGTTTTGTTATTTAACCCAATCATTGCTG AATGATTTTTTAAAAATGAGATGAGACGTAG AATGATTGGGTTAAATAACAAAACATTAGAC AATGATTATGGCTCAGGTACTGCTATCCACC CACCTTCATATGACGTCTATCCATTTATGTA AAATGATTTTTTAAAAATGAGATGAGACGTA AAATGATTATGGCTCAGGTACTGCTATCCAC ATTACAACTTCACCAGGTTCAACTCAAAAAA AAAATGATTATGGCTCAGGTACTGCTATCCA AAAAATGATTATGGCTCAGGTACTGCTATCC TGATAACACCTTCTACACCTCCATATCACAA TAATCACTTGGTATATCTTCACCAACACCTA TAACACCTTCTACACCTCCATATCACAAAAA GGTATATCTTCACCAACACCTAGTTTTTTCA ATGTAACATGTTAAAGGTAAGTCTACCGTCA GGCATGAAAAAACTAGGTGTTGGTGAAGATA CAAATGTAGTATTTATGTCAAAATAATGTTA GATGATAACACCTTCTACACCTCCATATCAC GATAACACCTTCTACACCTCCATATCACAAA GAAAAAACTAGGTGTTGGTGAAGATATACCA CCAACACCTAGTTTTTTCATGCCTTTTTCAA CATGAAAAAACTAGGTGTTGGTGAAGATATA CACCAACACCTAGTTTTTTCATGCCTTTTTC CAACACCTAGTTTTTTCATGCCTTTTTCAAA ATGATAACACCTTCTACACCTCCATATCACA ATGAAAAAACTAGGTGTTGGTGAAGATATAC ATATCTTCACCAACACCTAGTTTTTTCATGC ATAACACCTTCTACACCTCCATATCACAAAA AGGTGTTGGTGAAGATATACCAAGTGATTAT AGGCATGAAAAAACTAGGTGTTGGTGAAGAT AGATGATAACACCTTCTACACCTCCATATCA ACTAGGTGTTGGTGAAGATATACCAAGTGAT ACCAACACCTAGTTTTTTCATGCCTTTTTCA AATCACTTGGTATATCTTCACCAACACCTAG AAGGCATGAAAAAACTAGGTGTTGGTGAAGA AAGATGATAACACCTTCTACACCTCCATATC CCAATCTAACTTCCACATACCATCTTCTTTA AACTAGGTGTTGGTGAAGATATACCAAGTGA AACACCTTCTACACCTCCATATCACAAAAAT AACACCTAGTTTTTTCATGCCTTTTTCAAAT AAAGGCATGAAAAAACTAGGTGTTGGTGAAG AAAGATGATAACACCTTCTACACCTCCATAT AAACTAGGTGTTGGTGAAGATATACCAAGTG AACTATTATATATTTTTATCGGACGTTCAGT AAAAGGCATGAAAAAACTAGGTGTTGGTGAA AAAAGATGATAACACCTTCTACACCTCCATA AAAACTAGGTGTTGGTGAAGATATACCAAGT TTATCGTCTAATGTTTTGTTATTTAACCCAA AAAAAGGCATGAAAAAACTAGGTGTTGGTGA AAAAAGATGATAACACCTTCTACACCTCCAT AAAAACTAGGTGTTGGTGAAGATATACCAAG AAAAAAGATGATAACACCTTCTACACCTCCA AAAAAACTAGGTGTTGGTGAAGATATACCAA AATCCTCTATGTCCATATACAGTTAGCATAT GAGATGAGACGTAGATTAACTCCATAATCAA AAATTGGGTGGTTTATATCATATGATAAAGA ATAGCAATACAATCGCACATACATTAATAGA TCGCACATACATTAATAGAGAAAAAGAAAAA TCAGAACGTGGTAAAATTTTAGACCGAAACA TATTGAAAATTTAAAATCAGAACGTGGTAAA AGGTTACGGACAAGGTGAAATACTGATTAAC GTCTAAAATTTTACCACGTTCTGATTTTAAA GGTCTAAAATTTTACCACGTTCTGATTTTAA CATAAAGAAGATATTTATAGATCTTATGCAA GCAATACAATCGCACATACATTAATAGAGAA CTTTTTTCTTTTTCTCTATTAATGTATGTGC CTTTTTCTCTATTAATGTATGTGCGATTGTA CTCTATTAATGTATGTGCGATTGTATTGCTA CGGTCTAAAATTTTACCACGTTCTGATTTTA ATGGCAAAGATATTCAACTAACTATTGATGC CGCACATACATTAATAGAGAAAAAGAAAAAA CCACGTTCTGATTTTAAATTTTCAATATGTA CATTGTTTCGGTCTAAAATTTTACCACGTTC CATATTGAAAATTTAAAATCAGAACGTGGTA CATACATTAATAGAGAAAAAGAAAAAAGATG CAGAACGTGGTAAAATTTTAGACCGAAACAA CACATACATTAATAGAGAAAAAGAAAAAAGA CAATCGCACATACATTAATAGAGAAAAAGAA CAATACAATCGCACATACATTAATAGAGAAA ATTTTACCACGTTCTGATTTTAAATTTTCAA ATTTAAAATCAGAACGTGGTAAAATTTTAGA ATTGAAAATTTAAAATCAGAACGTGGTAAAA ATCGCACATACATTAATAGAGAAAAAGAAAA ATCAGAACGTGGTAAAATTTTAGACCGAAAC ATATTGAAAATTTAAAATCAGAACGTGGTAA ATTATATTCTTCGTTACTCATGCCATACATA ATACAATCGCACATACATTAATAGAGAAAAA ATTCTATTGCTTGTTTTAAGTCGATATTACC GCTAAAATAGTAAACACTGAAGATGCCAAAC AGCAATACAATCGCACATACATTAATAGAGA AGAACGTGGTAAAATTTTAGACCGAAACAAT ACATATTGAAAATTTAAAATCAGAACGTGGT ACATACATTAATAGAGAAAAAGAAAAAAGAT GATACCTTCGTTCCACTTAAAACCGTTAAAA ACAATCGCACATACATTAATAGAGAAAAAGA AATTTTACCACGTTCTGATTTTAAATTTTCA AATTTAAAATCAGAACGTGGTAAAATTTTAG AGTTAGAGGTGAGTCTTACGTTTCAGTGACG AATCGCACATACATTAATAGAGAAAAAGAAA AATCAGAACGTGGTAAAATTTTAGACCGAAA AATACAATCGCACATACATTAATAGAGAAAA AATTTTATATTGAGCATCTACTCGTTTTTTA AACGTGGTAAAATTTTAGACCGAAACAATGT AAGGAATGGCTAGCTACAATGCCAAAATCTC AAATTTTACCACGTTCTGATTTTAAATTTTC AAATTTAAAATCAGAACGTGGTAAAATTTTA AAATCAGAACGTGGTAAAATTTTAGACCGAA AAAATTTAAAATCAGAACGTGGTAAAATTTT AAAATCAGAACGTGGTAAAATTTTAGACCGA TAATTTTTTAGTATGTAACATGTTAAAGGTA CAAATTAATTTTTTAGTATGTAACATGTTAA ATTTTTTAGTATGTAACATGTTAAAGGTAAG ATTAATTTTTTAGTATGTAACATGTTAAAGG ACCTTTAACATGTTACATACTAAAAAATTAA AATTTTTTAGTATGTAACATGTTAAAGGTAA AATTAATTTTTTAGTATGTAACATGTTAAAG AAATTAATTTTTTAGTATGTAACATGTTAAA ACGGACTACAAATATGTCCGGGGAAATAACT TTAACAAAATTAAATTGAACGTTGCGATCAA TGCAAACTTAATTGGCAAATCCGGTACTGCA TGATCGCAACGTTCAATTTAATTTTGTTAAA TGAGTTCTGCAGTACCGGATTTGCCAATTAA TCGCAACGTTCAATTTAATTTTGTTAAAGAA TACCGGATTTGCCAATTAAGTTTGCATAAGA TAATTGGCAAATCCGGTACTGCAGAACTCAA TAAATTGAACGTTGCGATCAATGTTACCGTA GTCTGTAAAGATACCATCAACTCCCCAATTA GGCAAATCCGGTACTGCAGAACTCAAAATGA GCAACGTTCAATTTAATTTTGTTAAAGAAGA GCAAATCCGGTACTGCAGAACTCAAAATGAA CTTTAACAAAATTAAATTGAACGTTGCGATC CTTATGCAAACTTAATTGGCAAATCCGGTAC CTTAATTGGCAAATCCGGTACTGCAGAACTC CTGCAGTACCGGATTTGCCAATTAAGTTTGC CGCAACGTTCAATTTAATTTTGTTAAAGAAG CCGGATTTGCCAATTAAGTTTGCATAAGATC CATTTTGAGTTCTGCAGTACCGGATTTGCCA CAGTACCGGATTTGCCAATTAAGTTTGCATA CAAATCCGGTACTGCAGAACTCAAAATGAAA CAAACTTAATTGGCAAATCCGGTACTGCAGA ATTTTGAGTTCTGCAGTACCGGATTTGCCAA ATTGGCAAATCCGGTACTGCAGAACTCAAAA ATTGATCGCAACGTTCAATTTAATTTTGTTA ATTAAATTGAACGTTGCGATCAATGTTACCG ATGCAAACTTAATTGGCAAATCCGGTACTGC ATCTTCTTTAACAAAATTAAATTGAACGTTG ATCGCAACGTTCAATTTAATTTTGTTAAAGA AGTACCGGATTTGCCAATTAAGTTTGCATAA ACTTAATTGGCAAATCCGGTACTGCAGAACT ACGGTAACATTGATCGCAACGTTCAATTTAA ACCGGATTTGCCAATTAAGTTTGCATAAGAT ACAAAATTAAATTGAACGTTGCGATCAATGT AATTGGCAAATCCGGTACTGCAGAACTCAAA AATTAAATTGAACGTTGCGATCAATGTTACC AATCCGGTACTGCAGAACTCAAAATGAAACA AAGATGGCTATCGTGTCACAATCGTTGACGA AACTTAATTGGCAAATCCGGTACTGCAGAAC AATTACAAATAAGAAATCCATAAAAAAAGAA AACGTTCAATTTAATTTTGTTAAAGAAGATG AACATTGATCGCAACGTTCAATTTAATTTTG AACAAAATTAAATTGAACGTTGCGATCAATG AAATTAAATTGAACGTTGCGATCAATGTTAC AAATCCGGTACTGCAGAACTCAAAATGAAAC AAACTTAATTGGCAAATCCGGTACTGCAGAA AAAATTAAATTGAACGTTGCGATCAATGTTA
95 :     1.15735 TATTGAAGAATTAAACAAAGAAGAATTATCA TAGTGATAATTCTTCTTTGTTTAATTCTTCA GAAGAATTAAACAAAGAAGAATTATCACTAA ATTGAAGAATTAAACAAAGAAGAATTATCAC ATATTGAAGAATTAAACAAAGAAGAATTATC AGTGATAATTCTTCTTTGTTTAATTCTTCAA AAGAATTAAACAAAGAAGAATTATCACTAAT TATCACTAATTGAATTGGAGCAGTCATATAA TATATGACTGCTCCAATTCAATTAGTGATAA CCTTATATGACTGCTCCAATTCAATTAGTGA CACTAATTGAATTGGAGCAGTCATATAAGGA CAATTAGTGATAATTCTTCTTTGTTTAATTC CAAAGAAGAATTATCACTAATTGAATTGGAG ATTCAATTAGTGATAATTCTTCTTTGTTTAA ATTAAACAAAGAAGAATTATCACTAATTGAA ATGACTGCTCCAATTCAATTAGTGATAATTC ATCACTAATTGAATTGGAGCAGTCATATAAG ATATGACTGCTCCAATTCAATTAGTGATAAT AGAATTATCACTAATTGAATTGGAGCAGTCA ACAAAGAAGAATTATCACTAATTGAATTGGA AATTATCACTAATTGAATTGGAGCAGTCATA AATTAGTGATAATTCTTCTTTGTTTAATTCT AATTAAACAAAGAAGAATTATCACTAATTGA AACAAAGAAGAATTATCACTAATTGAATTGG AAACAAAGAAGAATTATCACTAATTGAATTG AATTCAATTAGTGATAATTCTTCTTTGTTTA
96 :     0.835019 GACAGATAGCGCACGCAAAGAATACTTAAGC CTTAAGTATTCTTTGCGTGCGCTATCTGTCA CAGATAGCGCACGCAAAGAATACTTAAGCCG ACAGATAGCGCACGCAAAGAATACTTAAGCC ATGACAGATAGCGCACGCAAAGAATACTTAA GAGCCGAAAAATCGGCTTAAGTATTCTTTGC CGCACGCAAAGAATACTTAAGCCGATTTTTC CGAAAAATCGGCTTAAGTATTCTTTGCGTGC CACGCAAAGAATACTTAAGCCGATTTTTCGG ATCGGCTTAAGTATTCTTTGCGTGCGCTATC AGCCGAAAAATCGGCTTAAGTATTCTTTGCG AGATAGCGCACGCAAAGAATACTTAAGCCGA ACGCAAAGAATACTTAAGCCGATTTTTCGGC AATCGGCTTAAGTATTCTTTGCGTGCGCTAT AAATCGGCTTAAGTATTCTTTGCGTGCGCTA AAAATCGGCTTAAGTATTCTTTGCGTGCGCT AAAAATCGGCTTAAGTATTCTTTGCGTGCGC
97 :     0.817668 TGATTATACTTAACATTAAAAAAGATGATAA GTGTTATCATCTTTTTTAATGTTAAGTATAA GGTGTTATCATCTTTTTTAATGTTAAGTATA CTGATTATACTTAACATTAAAAAAGATGATA ATTATACTTAACATTAAAAAAGATGATAACA ACTGATTATACTTAACATTAAAAAAGATGAT TCACTAAAAAAATTACACATATCGTGAGCAA GCTCACGATATGTGTAATTTTTTTAGTGAGA CTCACTAAAAAAATTACACATATCGTGAGCA CTCACGATATGTGTAATTTTTTTAGTGAGAA CACGATATGTGTAATTTTTTTAGTGAGAATG ATTCTCACTAAAAAAATTACACATATCGTGA AGCATTCTCACTAAAAAAATTACACATATCG ACTAAAAAAATTACACATATCGTGAGCAATG CAGTTTCTCCTTGTTTCATTTTGAGTTCTGC AGTTTCTCCTTGTTTCATTTTGAGTTCTGCA CAGAACTCAAAATGAAACAAGGAGAAACTGG GATTATACTTAACATTAAAAAAGATGATAAC TATTATCACATTAATCGCACTTTTATTTCCA GGAAATAAAAGTGCGATTAATGTGATAATAC GAAATAAAAGTGCGATTAATGTGATAATACA ATGGAAATAAAAGTGCGATTAATGTGATAAT AATAAAAGTGCGATTAATGTGATAATACAGT GTATATTTTATATAGAGCATTCTCACTAAAA TTAATGTGATAATACAGTTACGTTAATTAAA TGTGATAATACAGTTACGTTAATTAAAAAAA TATTTTTTTAATTAACGTAACTGTATTATCA TAATGTGATAATACAGTTACGTTAATTAAAA TAATACAGTTACGTTAATTAAAAAAATAAAA TAAAAGTGCGATTAATGTGATAATACAGTTA GTGCGATTAATGTGATAATACAGTTACGTTA CATTTTTATTTTTTTAATTAACGTAACTGTA ATTTTTTTAATTAACGTAACTGTATTATCAC ATTAACGTAACTGTATTATCACATTAATCGC ATGTGATAATACAGTTACGTTAATTAAAAAA ATACAGTTACGTTAATTAAAAAAATAAAAAT ATAATACAGTTACGTTAATTAAAAAAATAAA AATTAACGTAACTGTATTATCACATTAATCG AATGTGATAATACAGTTACGTTAATTAAAAA AATACAGTTACGTTAATTAAAAAAATAAAAA AAGTGCGATTAATGTGATAATACAGTTACGT AACTGTATTATCACATTAATCGCACTTTTAT AACGTAACTGTATTATCACATTAATCGCACT AAAGTGCGATTAATGTGATAATACAGTTACG AAAAGTGCGATTAATGTGATAATACAGTTAC ATTGCTCACGATATGTGTAATTTTTTTAGTG GATTAATGTGATAATACAGTTACGTTAATTA TCAAAATGAAACAAGGAGAAACTGGCAGACA GAACTCAAAATGAAACAAGGAGAAACTGGCA CTCAAAATGAAACAAGGAGAAACTGGCAGAC CCCAATTTGTCTGCCAGTTTCTCCTTGTTTC CCAATTTGTCTGCCAGTTTCTCCTTGTTTCA CAAAATGAAACAAGGAGAAACTGGCAGACAA ATGAAACAAGGAGAAACTGGCAGACAAATTG AGAACTCAAAATGAAACAAGGAGAAACTGGC ACTCAAAATGAAACAAGGAGAAACTGGCAGA ACCACCCAATTTGTCTGCCAGTTTCTCCTTG ACAAGGAGAAACTGGCAGACAAATTGGGTGG AATGAAACAAGGAGAAACTGGCAGACAAATT AACAAGGAGAAACTGGCAGACAAATTGGGTG AAATGAAACAAGGAGAAACTGGCAGACAAAT AAACAAGGAGAAACTGGCAGACAAATTGGGT AAAATGAAACAAGGAGAAACTGGCAGACAAA TGAGCAATGAACTGATTATACTTAACATTAA GCAATGAACTGATTATACTTAACATTAAAAA GAGCAATGAACTGATTATACTTAACATTAAA CATCTTTTTTAATGTTAAGTATAATCAGTTC CAATGAACTGATTATACTTAACATTAAAAAA ATGAACTGATTATACTTAACATTAAAAAAGA AGCAATGAACTGATTATACTTAACATTAAAA AATGAACTGATTATACTTAACATTAAAAAAG AACTGATTATACTTAACATTAAAAAAGATGA AAATAAAAGTGCGATTAATGTGATAATACAG AACTCAAAATGAAACAAGGAGAAACTGGCAG ATTAATGTGATAATACAGTTACGTTAATTAA GGAGAAACTGGCAGACAAATTGGGTGGTTTA CTGGCAGACAAATTGGGTGGTTTATATCATA ATATGATATAAACCACCCAATTTGTCTGCCA ATATAAACCACCCAATTTGTCTGCCAGTTTC ATAAACCACCCAATTTGTCTGCCAGTTTCTC AGAAACTGGCAGACAAATTGGGTGGTTTATA ACTGGCAGACAAATTGGGTGGTTTATATCAT AACTGGCAGACAAATTGGGTGGTTTATATCA AACCACCCAATTTGTCTGCCAGTTTCTCCTT AAACTGGCAGACAAATTGGGTGGTTTATATC AAACCACCCAATTTGTCTGCCAGTTTCTCCT TGCGATTAATGTGATAATACAGTTACGTTAA TATTTTATATAGAGCATTCTCACTAAAAAAA TATATTTTATATAGAGCATTCTCACTAAAAA TATATAGAGCATTCTCACTAAAAAAATTACA TATAGAGCATTCTCACTAAAAAAATTACACA TAGAGCATTCTCACTAAAAAAATTACACATA TAATTTTTTTAGTGAGAATGCTCTATATAAA GTAATTTTTTTAGTGAGAATGCTCTATATAA ATTTTATATAGAGCATTCTCACTAAAAAAAT ATATTTTATATAGAGCATTCTCACTAAAAAA ATATAGAGCATTCTCACTAAAAAAATTACAC ATAGAGCATTCTCACTAAAAAAATTACACAT AGAGCATTCTCACTAAAAAAATTACACATAT AATTTTTTTAGTGAGAATGCTCTATATAAAA GATAATACAGTTACGTTAATTAAAAAAATAA ATCTTTTTTAATGTTAAGTATAATCAGTTCA TAGAAGGTGTTATCATCTTTTTTAATGTTAA GTAGAAGGTGTTATCATCTTTTTTAATGTTA GGAGGTGTAGAAGGTGTTATCATCTTTTTTA GAGGTGTAGAAGGTGTTATCATCTTTTTTAA ACGATATGTGTAATTTTTTTAGTGAGAATGC CATTAAAAAAGATGATAACACCTTCTACACC AGGTGTTATCATCTTTTTTAATGTTAAGTAT AGGTGTAGAAGGTGTTATCATCTTTTTTAAT AGAAGGTGTTATCATCTTTTTTAATGTTAAG ACTTAACATTAAAAAAGATGATAACACCTTC ACATTAAAAAAGATGATAACACCTTCTACAC AAGGTGTTATCATCTTTTTTAATGTTAAGTA AACATTAAAAAAGATGATAACACCTTCTACA GAGCATTCTCACTAAAAAAATTACACATATC
98 :     0.759743 GCATCTTTATCATCTTCAGTTGTATTTGTAA AGTTACAAATACAACTGAAGATGATAAAGAT CATCTTTATCATCTTCAGTTGTATTTGTAAC
99 :     0.750016 TACCACTTCATATCTTGTAACGTTGTAACCA GTTACAACGTTACAAGATATGAAGTGGTAAA GGTTACAACGTTACAAGATATGAAGTGGTAA CATTTACCACTTCATATCTTGTAACGTTGTA ATTTACCACTTCATATCTTGTAACGTTGTAA ATTACCATTTACCACTTCATATCTTGTAACG ACGTTACAAGATATGAAGTGGTAAATGGTAA ACCATTTACCACTTCATATCTTGTAACGTTG ACCACTTCATATCTTGTAACGTTGTAACCAC ACAACGTTACAAGATATGAAGTGGTAAATGG AACGTTACAAGATATGAAGTGGTAAATGGTA TTCATATCTTGTAACGTTGTAACCACCCCAA TAAATCTTGGGGTGGTTACAACGTTACAAGA GCAAAAAGATAAATCTTGGGGTGGTTACAAC CTTGGGGTGGTTACAACGTTACAAGATATGA CTTCATATCTTGTAACGTTGTAACCACCCCA CCACTTCATATCTTGTAACGTTGTAACCACC CATATCTTGTAACGTTGTAACCACCCCAAGA CACTTCATATCTTGTAACGTTGTAACCACCC CAAAAAGATAAATCTTGGGGTGGTTACAACG ATATCTTGTAACGTTGTAACCACCCCAAGAT ATAAATCTTGGGGTGGTTACAACGTTACAAG AGATAAATCTTGGGGTGGTTACAACGTTACA ACTTCATATCTTGTAACGTTGTAACCACCCC AATCTTGGGGTGGTTACAACGTTACAAGATA AAGATAAATCTTGGGGTGGTTACAACGTTAC AAATCTTGGGGTGGTTACAACGTTACAAGAT AAAGATAAATCTTGGGGTGGTTACAACGTTA AAAAGATAAATCTTGGGGTGGTTACAACGTT AAAAAGATAAATCTTGGGGTGGTTACAACGT GATAAATCTTGGGGTGGTTACAACGTTACAA
100 :     0.762908 TTCAAACCATTCATCTAATAGTGTATGAAAA TTAGATGAATGGTTTGAATATCATACAAAAA TATTCAAACCATTCATCTAATAGTGTATGAA TATTAGATGAATGGTTTGAATATCATACAAA CTATTAGATGAATGGTTTGAATATCATACAA CATACACTATTAGATGAATGGTTTGAATATC CACTATTAGATGAATGGTTTGAATATCATAC ATTAGATGAATGGTTTGAATATCATACAAAA ATGTTTTTGTATGATATTCAAACCATTCATC ATGATATTCAAACCATTCATCTAATAGTGTA ATATTCAAACCATTCATCTAATAGTGTATGA ACTTTTCATACACTATTAGATGAATGGTTTG ACTATTAGATGAATGGTTTGAATATCATACA AACCATTCATCTAATAGTGTATGAAAAGTCA AAACCATTCATCTAATAGTGTATGAAAAGTC TAAAGCCAGATGTTTTTGTATGATATTCAAA CAGATGTTTTTGTATGATATTCAAACCATTC ATGGTTTGAATATCATACAAAAACATCTGGC AGCCAGATGTTTTTGTATGATATTCAAACCA AATGGTTTGAATATCATACAAAAACATCTGG AAGCCAGATGTTTTTGTATGATATTCAAACC AAAGCCAGATGTTTTTGTATGATATTCAAAC ATGAATGGTTTGAATATCATACAAAAACATC GTTTTTGTATGATATTCAAACCATTCATCTA AGATGTTTTTGTATGATATTCAAACCATTCA ACCATTCATCTAATAGTGTATGAAAAGTCAA ACACTATTAGATGAATGGTTTGAATATCATA ATTCAAACCATTCATCTAATAGTGTATGAAA AGATGAATGGTTTGAATATCATACAAAAACA CTTTTCATACACTATTAGATGAATGGTTTGA ATACACTATTAGATGAATGGTTTGAATATCA
101 :     0.712691 CATTATATTTACAAGGTTATAACAGTGCAAA AAAGCATTATATTTACAAGGTTATAACAGTG AGCATTATATTTACAAGGTTATAACAGTGCA TGCTTTTGCTTCAGCTGAATTTTGATACCAA CTTGGTATCAAAATTCAGCTGAAGCAAAAGC ATGCTTTTGCTTCAGCTGAATTTTGATACCA GTTCCGCTAGAGTAGAACGTTGCCAGGCAAA GCATTATATTTACAAGGTTATAACAGTGCAA TTCAGCTGAAGCAAAAGCATTATATTTACAA GTATCAAAATTCAGCTGAAGCAAAAGCATTA GCAAAAGCATTATATTTACAAGGTTATAACA GAAGCAAAAGCATTATATTTACAAGGTTATA CTTGTAAATATAATGCTTTTGCTTCAGCTGA CTGAAGCAAAAGCATTATATTTACAAGGTTA CAGCTGAAGCAAAAGCATTATATTTACAAGG CAAAAGCATTATATTTACAAGGTTATAACAG ATTCAGCTGAAGCAAAAGCATTATATTTACA ATCAAAATTCAGCTGAAGCAAAAGCATTATA ATATAATGCTTTTGCTTCAGCTGAATTTTGA ATAATGCTTTTGCTTCAGCTGAATTTTGATA ATAACCTTGTAAATATAATGCTTTTGCTTCA AGCAAAAGCATTATATTTACAAGGTTATAAC AATTCAGCTGAAGCAAAAGCATTATATTTAC AATGCTTTTGCTTCAGCTGAATTTTGATACC AATATAATGCTTTTGCTTCAGCTGAATTTTG AAGCAAAAGCATTATATTTACAAGGTTATAA AACCTTGTAAATATAATGCTTTTGCTTCAGC AAATTCAGCTGAAGCAAAAGCATTATATTTA AAAATTCAGCTGAAGCAAAAGCATTATATTT AAAAGCATTATATTTACAAGGTTATAACAGT ACCTTGTAAATATAATGCTTTTGCTTCAGCT AAGCATTATATTTACAAGGTTATAACAGTGC
102 :     0.729705 GCTTTACTAGGTAATCCTCTATGTCCATATA GAGCTTTACTAGGTAATCCTCTATGTCCATA AGCTTTACTAGGTAATCCTCTATGTCCATAT ATGGACATAGAGGATTACCTAGTAAAGCTCC
103 :     0.816417 TGAGATTAGTACATATAATAAATGGAGCCCA CTCCATTTATTATATGTACTAATCTCATAAA CCATTTATTATATGTACTAATCTCATAAAAA CATTTATTATATGTACTAATCTCATAAAAAA ATTTATTATATGTACTAATCTCATAAAAAAT ATGAGATTAGTACATATAATAAATGGAGCCC AGGCATGATTAAATGGGCTCCATTTATTATA AGAGGCATGATTAAATGGGCTCCATTTATTA ACATATAATAAATGGAGCCCATTTAATCATG ATAAATGGAGCCCATTTAATCATGCCTCTTC AAGAGGCATGATTAAATGGGCTCCATTTATT TTAAATGGGCTCCATTTATTATATGTACTAA GTACATATAATAAATGGAGCCCATTTAATCA ATTAAATGGGCTCCATTTATTATATGTACTA ATGGGCTCCATTTATTATATGTACTAATCTC ATGATTAAATGGGCTCCATTTATTATATGTA AGTACATATAATAAATGGAGCCCATTTAATC AATGGGCTCCATTTATTATATGTACTAATCT AAATGGGCTCCATTTATTATATGTACTAATC GGCTCCATTTATTATATGTACTAATCTCATA ATAATAAATGGAGCCCATTTAATCATGCCTC CATATAATAAATGGAGCCCATTTAATCATGC GCTCCATTTATTATATGTACTAATCTCATAA TCCATTTATTATATGTACTAATCTCATAAAA ATATAATAAATGGAGCCCATTTAATCATGCC ATTAGTACATATAATAAATGGAGCCCATTTA GGAAGAGGCATGATTAAATGGGCTCCATTTA
104 :     End_of_SA_DP
105 :    
106 :     my %load = &Load_Adaboost ($SA_DP);
107 :     $AdaboostValues{'Staphylococcus aureus'}{methicillin}{ADABOOST} = \%load;
108 :     $AdaboostValues{'Staphylococcus aureus'}{methicillin}{RESISTANT} = '1422580.3 1422406.3 1422564.3 1422719.3 1422517.3 1413406.3 1413428.3 1422624.3 1413433.3 1422395.3 1422577.3 1422531.3 1413434.3 1422571.3 1422536.3 1413349.3 1413572.3 1422449.3 1422646.3 1422409.3 1422526.3 1422709.3 1422707.3 1422704.3 1413402.3 1413331.3 1422584.3 1422673.3 1422593.3 1422562.3 1422728.3 1413578.3 1422607.3 1422410.3 1413437.3 1422567.3 1413581.3 1413477.3 1413384.3 1413467.3 1413457.3 1422558.3 1422617.3 1422657.3 1413332.3 1422419.3 1422553.3 1422402.3 1413394.3 1422643.3 1422683.3 1422696.3 1422497.3 1422391.3 1422659.3 1422544.3 1422474.3 1422595.3 1422625.3 1422692.3 1422431.3 1422569.3 1422572.3 1422481.3 1422585.3 1413458.3 1413519.3 1422529.3 1422745.3 1422425.3 1413466.3 1422495.3 1422485.3 1422524.3 1422627.3 1422521.3 1422421.3 1422722.3 1422740.3 1413347.3 1422466.3 1422510.3 1422424.3 1422592.3 1422647.3 1422404.3 1422469.3 1422691.3 1422491.3 1422414.3 1413425.3 1422568.3 1422713.3 1422441.3 1413470.3 1422721.3 1422699.3 1413523.3 1413412.3 1422739.3 1422689.3 1422457.3 1422464.3 1413418.3 1413587.3 1422509.3 1413334.3 1422461.3 1422493.3 1422399.3 1413576.3 1422513.3 1422397.3 1422426.3 1422604.3';
109 :     $AdaboostValues{'Staphylococcus aureus'}{methicillin}{SUSCEPTIBLE} = '1413589.3 1413512.3 1422800.3 1413506.3 1422789.3 1413585.3 1413348.3 1422767.3 1413354.3 1422764.3 1422774.3 1413509.3 1422784.3 1422813.3 1413497.3 1422758.3 1422797.3 1413501.3 1413489.3 1413502.3 1413415.3 1422790.3 1413493.3 1413499.3 1413351.3 1422763.3 1422760.3 1413500.3 1422772.3 1422775.3 1422791.3 1413583.3 1422770.3 1413605.3 1422799.3 1413505.3 1422805.3 1422786.3 1413608.3 1422769.3 1413491.3 1413584.3 1413482.3 1413582.3 1422754.3 1413495.3 1422766.3 1413609.3 1422804.3 1422777.3 1422794.3 1422803.3 1422793.3 1413498.3 1422809.3 1422788.3 1422806.3 1422807.3 1422762.3 1422761.3 1413511.3 1413508.3 1422773.3 1413454.3 1422783.3 1413481.3 1413607.3 1422765.3 1422802.3 1422795.3 1422768.3 1413503.3 1413492.3 1422771.3 1422796.3 1413606.3 1413414.3 1413590.3 1413398.3 1422792.3 1422810.3 1413375.3 1413455.3 1413496.3 1413594.3 1422756.3 1422778.3 1422812.3 1422787.3 1422782.3 1413504.3 1413510.3 1422798.3 1422755.3 1422757.3 1422753.3 1422779.3 1413602.3 1413490.3 1422785.3 1413327.3 1422752.3 1422780.3 1413598.3 1422781.3 1413494.3 1413507.3 1422801.3 1422759.3 1413400.3 1413397.3 1413593.3 1413604.3 1413483.3 1413350.3';
110 :     $AdaboostValues{'Staphylococcus aureus'}{methicillin}{AUC} = '0.991';
111 :     $AdaboostValues{'Staphylococcus aureus'}{methicillin}{F1} = '0.995';
112 :     $AdaboostValues{'Staphylococcus aureus'}{methicillin}{ACCURACY} = '0.995';
113 :     $AdaboostValues{'Staphylococcus aureus'}{methicillin}{SOURCES} = 'MRSA CLEAR, MRSA ST398, and MRSA USA100 (Ashley Robinson) initiatives, Broad Institute (broadinstitute.org)';
114 :     $AdaboostValues{'Staphylococcus aureus'}{methicillin}{FUNCTION} = 'Methicillin resistance predicted region';
115 :    
116 :    
117 :     #-------------------------------------------------------------
118 :    
119 :    
120 :    
121 :    
122 :     #-------------------------------------------------------------
123 :     # Streptococcus pneumoniae
124 :     #-------------------------------------------------------------
125 :    
126 :     # beta-lactam
127 :    
128 :     $AdaboostValues{'Streptococcus pneumoniae'}{'beta-lactam'}{ANTIBIOTICS} = 'penicillin ceftriaxone';
129 :     $AdaboostValues{'Streptococcus pneumoniae'}{'beta-lactam'}{ABBREVIATIONS} = 'P CRO';
130 :    
131 :     my $SP_BLAC = <<"End_of_SP_BLAC";
132 :     0.740843 CTTTGGCTTGACAGATGAATACGCTGGTCAA GCTTTGGCTTGACAGATGAATACGCTGGTCA CTGGAAGTTGACCAGCGTATTCATCTGTCAA ACAGATGAATACGCTGGTCAACTTCCAGCTG ACTCGCTTTGGCTTGACAGATGAATACGCTG AGTTGACCAGCGTATTCATCTGTCAAGCCAA AAGTTGACCAGCGTATTCATCTGTCAAGCCA GAAGTTGACCAGCGTATTCATCTGTCAAGCC CTTGACAGATGAATACGCTGGTCAACTTCCA GCTGGAAGTTGACCAGCGTATTCATCTGTCA CGCTTTGGCTTGACAGATGAATACGCTGGTC CCAGCGTATTCATCTGTCAAGCCAAAGCGAG ACCAGCGTATTCATCTGTCAAGCCAAAGCGA GTTGACCAGCGTATTCATCTGTCAAGCCAAA GCTTGACAGATGAATACGCTGGTCAACTTCC CAGATGAATACGCTGGTCAACTTCCAGCTGA AGCTGGAAGTTGACCAGCGTATTCATCTGTC
133 :     0.620571 ATTCAAACCGCGTCAACGTCGCCTTGCCGTA
134 :     0.5981 TAGAAGAAATTCCAGACATGTATGGCTGGAA GCCATACATGTCTGGAATTTCTTCTACCTTA AAGGTAGAAGAAATTCCAGACATGTATGGCT CCAGCCATACATGTCTGGAATTTCTTCTACC AAATTCCAGACATGTATGGCTGGAAAAAAGA AAGAAATTCCAGACATGTATGGCTGGAAAAA CTTTTTTCCAGCCATACATGTCTGGAATTTC AGGTAGAAGAAATTCCAGACATGTATGGCTG AGAAATTCCAGACATGTATGGCTGGAAAAAA GTAGAAGAAATTCCAGACATGTATGGCTGGA CATACATGTCTGGAATTTCTTCTACCTTATC AGAAGAAATTCCAGACATGTATGGCTGGAAA ATAAGGTAGAAGAAATTCCAGACATGTATGG GAAGAAATTCCAGACATGTATGGCTGGAAAA
135 :     0.495674 GATGTGGATGCGATTTTGTTTGTTGTCCCAA AGATGTGGATGCGATTTTGTTTGTTGTCCCA
136 :     0.356604 CAGGCTGTTGAACCGTTACATACAAGATAAA TCAGGCTGTTGAACCGTTACATACAAGATAA
137 :     0.406669 AAAATCAATCCCCTTGACCTCTGCAGTTTCC AACTGCAGAGGTCAAGGGGATTGATTTTACA GAAACTGCAGAGGTCAAGGGGATTGATTTTA ACTGCAGAGGTCAAGGGGATTGATTTTACAA AAATCAATCCCCTTGACCTCTGCAGTTTCCA AAACTGCAGAGGTCAAGGGGATTGATTTTAC AATCAATCCCCTTGACCTCTGCAGTTTCCAA
138 :     0.334589 ATAAGTTCTTCCATCTCTGGACTTCCAGATA AAATTATCTGGAAGTCCAGAGATGGAAGAAC AAGTTCTTCCATCTCTGGACTTCCAGATAAT AAAATTATCTGGAAGTCCAGAGATGGAAGAA TAAGTTCTTCCATCTCTGGACTTCCAGATAA AATTATCTGGAAGTCCAGAGATGGAAGAACT
139 :     0.273609 CGATGCCTTGGTGGTAGCAGACGAGGAAGTC
140 :     0.204059 AAATAGGTATCTCCCTCCACCCGAGCATGAA AATAGGTATCTCCCTCCACCCGAGCATGAAT
141 :     0.20504 CACTAAAGATAGAATCTAGGTCATTGGGTTC ACTAAAGATAGAATCTAGGTCATTGGGTTCA ATGAACCCAATGACCTAGATTCTATCTTTAG
142 :     End_of_SP_BLAC
143 :    
144 :     my %load = &Load_Adaboost ($SP_BLAC);
145 :     $AdaboostValues{'Streptococcus pneumoniae'}{'beta-lactam'}{ADABOOST} = \%load;
146 :     $AdaboostValues{'Streptococcus pneumoniae'}{'beta-lactam'}{RESISTANT} = '1313.4276 1313.4730 1313.2353 1313.4283 1313.4250 1313.4819 1313.3738 1313.3034 1313.2695 1313.4291 1313.4948 1313.2318 1313.3287 1313.4752 1313.2783 1313.2221 1313.2936 1313.2909 1313.2358 1313.4415 1313.3750 1313.4988 1313.4924 1313.2646 1313.2637 1313.4092 1313.2640 1313.4248 1313.2444 1313.4740 1313.2775 1313.2707 1313.3124 1313.3792 1313.3936 1313.2834 1313.2475 1313.2985 1313.3044 1313.2617 1313.4272 1313.2672 1313.3968 1313.3496 1313.2451 1313.2464 1313.4252 1313.2785 1313.4212 1313.4157 1313.2552 1313.4938 1313.2798 1313.2230 1313.2347 1313.2631 1313.2784 1313.3735 1313.3740 1313.3352 1313.3104 1313.3804 1313.4774 1313.3351 1313.2426 1313.4749 1313.2291 1313.4998 1313.2653 1313.3163 1313.4297 1313.2602 1313.2446 1313.2350 1313.2182 1313.2709 1313.4156 1313.3724 1313.2282 1313.4260 1313.3782 1313.2339 1313.2554 1313.4201 1313.2374 1313.3068 1313.2937 1313.4829 1313.3781 1313.5046 1313.4745 1313.2197 1313.2836 1313.3754 1313.4306 1313.2774 1313.2513 1313.2850 1313.2379 1313.2935 1313.4610 1313.4855 1313.2184 1313.4891 1313.4762 1313.3717 1313.2485 1313.2362 1313.4832 1313.4271 1313.2547 1313.2471 1313.3803 1313.2320 1313.4734 1313.2899 1313.2337 1313.3445 1313.3313 1313.3058 1313.3151 1313.2447 1313.2407 1313.4490 1313.2177 1313.2609 1313.2175 1313.4750 1313.2698 1313.2570 1313.4786 1313.3965 1313.2699 1313.2292 1313.2884 1313.4848 1313.2913 1313.3093 1313.4215 1313.4886 1313.2700 1313.3376 1313.4825 1313.4251 1313.2188 1313.2679 1313.4861 1313.2618 1313.3076 1313.2872 1313.3795 1313.4799 1313.3745 1313.2974 1313.2615 1313.4180 1313.2245 1313.2425 1313.2460 1313.2795 1313.3917 1313.2898 1313.2398 1313.2597 1313.2692 1313.3483 1313.2705 1313.2642 1313.2369 1313.3787 1313.3031 1313.5227 1313.3078 1313.2372 1313.2494 1313.4843 1313.2521 1313.2932 1313.3984 1313.2361 1313.2896 1313.4080 1313.4858 1313.3089 1313.4158 1313.2665 1313.4346 1313.2319 1313.2881 1313.2413 1313.2489 1313.2992 1313.2621 1313.2620 1313.3125 1313.4170 1313.3042 1313.2254 1313.4294 1313.2506 1313.4782 1313.2912 1313.4186 1313.4896 1313.4889 1313.4805 1313.3288 1313.3065 1313.3346 1313.2748 1313.2568 1313.2516 1313.3962 1313.4234 1313.3306 1313.3977 1313.2675 1313.3939 1313.4763 1313.5218 1313.4931 1313.4731 1313.4605 1313.2874 1313.2305 1313.3311 1313.4613 1313.3500 1313.4751 1313.2461 1313.2449 1313.3773 1313.3927 1313.2598 1313.4086 1313.3040 1313.2514 1313.3309 1313.4905 1313.3971 1313.2889 1313.2842 1313.4296 1313.2728 1313.2674 1313.3978 1313.4286 1313.4735 1313.4609 1313.3800 1313.2848 1313.4824 1313.3120 1313.3736 1313.4199 1313.3149 1313.4489 1313.4796 1313.4089 1313.3959 1313.4773 1313.2902 1313.3785 1313.2914 1313.4728 1313.2657 1313.3315 1313.4863 1313.4857 1313.2943 1313.3994 1313.2403 1313.3312 1313.3784 1313.3812 1313.4904 1313.3726 1313.3913 1313.4202 1313.2818 1313.2525 1313.3762 1313.4203 1313.2357 1313.2849 1313.2882 1313.2389 1313.3829 1313.2186 1313.2862 1313.4268 1313.2415 1313.3918 1313.4742 1313.2904 1313.4242 1313.2445 1313.2452 1313.3162 1313.4813 1313.2329 1313.2735 1313.2466 1313.4907 1313.2573 1313.2777 1313.2211 1313.3625 1313.3045 1313.2193 1313.2693 1313.3749 1313.2281 1313.2566 1313.2226 1313.2757 1313.2539 1313.2298 1313.3247 1313.2562 1313.2267 1313.2317 1313.4282 1313.4807 1313.4994 1313.4397 1313.4788 1313.3358 1313.5000 1313.3497 1313.4836 1313.2520 1313.3176 1313.3073 1313.4940 1313.3160 1313.4228 1313.2668 1313.4225 1313.2436 1313.3732 1313.2769 1313.3157 1313.2782 1313.4884 1313.3761 1313.3143 1313.4085 1313.2559 1313.2779 1313.2949 1313.3771 1313.4939 1313.2255 1313.4279 1313.4307 1313.3232 1313.4790 1313.2321 1313.5156 1313.2671 1313.2528 1313.2408 1313.4221 1313.2619 1313.2601 1313.3174 1313.3920 1313.3485 1313.2557 1313.3339 1313.2571 1313.2260 1313.2365 1313.4928 1313.4840 1313.3161 1313.2979 1313.3798 1313.4875 1313.3070 1313.2249 1313.4266 1313.2920 1313.2456 1313.2519 1313.3794 1313.5004 1313.4305 1313.3005 1313.2876 1313.4841 1313.2216 1313.3484 1313.3643 1313.2266 1313.2287 1313.2930 1313.4254 1313.2218 1313.2855 1313.3032 1313.2262 1313.4760 1313.4292 1313.3935 1313.4801 1313.4936 1313.4077 1313.3168 1313.4787 1313.2871 1313.2536 1313.5230 1313.3155 1313.2424 1313.3753 1313.3051 1313.2565 1313.2370 1313.2986 1313.4906 1313.2998 1313.4084 1313.3990 1313.2844 1313.4208 1313.2820 1313.5212 1313.2437 1313.3015 1313.3385 1313.2498 1313.2183 1313.3993 1313.3072 1313.4071 1313.2531 1313.3156 1313.3067 1313.4921 1313.4229 1313.4726 1313.2587 1313.4756 1313.2787 1313.2410 1313.2608 1313.2300 1313.4881 1313.2393 1313.2490 1313.4830 1313.4493 1313.3083 1313.2323 1313.3898 1313.4991 1313.2420 1313.4102 1313.4175 1313.3925 1313.4772 1313.2929 1313.2569 1313.2630 1313.5048 1313.2891 1313.4898 1313.2839 1313.3064 1313.3081 1313.4235 1313.2664 1313.4933 1313.3755 1313.3487 1313.3757 1313.2326 1313.2330 1313.5034 1313.3807 1313.2667 1313.2253 1313.4920 1313.2500 1313.4220 1313.2737 1313.3357 1313.2302 1313.3799 1313.4074 1313.4246 1313.2295 1313.2561 1313.4860 1313.2694 1313.3739 1313.2509 1313.2645 1313.4278 1313.2643 1313.2310 1313.2655 1313.4833 1313.2940 1313.4244 1313.3390 1313.2404 1313.3238 1313.2771 1313.3236 1313.3365 1313.2952 1313.3085 1313.3900 1313.2325 1313.3980 1313.3988 1313.3299 1313.2493 1313.5006 1313.2258 1313.5009 1313.4811 1313.4783 1313.3721 1313.3802 1313.2603 1313.4995 1313.2324 1313.4410 1313.2733 1313.2438 1313.3095 1313.4238 1313.2257 1313.4844 1313.3996 1313.4269 1313.4155 1313.2658 1313.2553 1313.2863 1313.2833 1313.4247 1313.5016 1313.2611 1313.2196 1313.4823 1313.2316 1313.2706 1313.2752 1313.2869 1313.2883 1313.3929 1313.2677 1313.3245 1313.3778 1313.3627 1313.2917 1313.2540 1313.2386 1313.2504 1313.2763 1313.2224 1313.4826 1313.4308 1313.2866 1313.4236 1313.4739 1313.3092 1313.4925 1313.4761 1313.2870 1313.5228 1313.3502 1313.2877 1313.2681 1313.4952 1313.4275 1313.2829 1313.2765 1313.2290 1313.2997 1313.3956 1313.2944 1313.2840 1313.4765 1313.2201 1313.3387 1313.2499 1313.3992 1313.2272 1313.3764 1313.2240 1313.4082 1313.4349 1313.4781 1313.2659 1313.4287 1313.2311 1313.4083 1313.2796 1313.3251 1313.3624 1313.4300 1313.3145 1313.4777 1313.2934 1313.4854 1313.2454 1313.2651 1313.2762 1313.2710 1313.4798 1313.3164 1313.2229 1313.2491 1313.4227 1313.3369 1313.2419 1313.2469 1313.2480 1313.2434 1313.2214 1313.2213 1313.2409 1313.2400 1313.3035 1313.2307 1313.3737 1313.4990 1313.4087 1313.2788 1313.2210 1313.2873 1313.2289 1313.4356 1313.2351 1313.2492 1313.2558 1313.4240 1313.3765 1313.2208 1313.2507 1313.4868 1313.3274 1313.2830 1313.2334 1313.3119 1313.4853 1313.4612 1313.3915 1313.2250 1313.2488 1313.3756 1313.2244 1313.2333 1313.2906 1313.2549 1313.2950 1313.4198 1313.3172 1313.2312 1313.4784 1313.2487 1313.4257 1313.3380 1313.3165 1313.2284 1313.4873 1313.4741 1313.3723 1313.3389 1313.3486 1313.2474 1313.2265 1313.3944 1313.2916 1313.3930 1313.2176 1313.2964 1313.4290 1313.3491 1313.3897 1313.2648 1313.2968 1313.2416 1313.2687 1313.2273 1313.2376 1313.2511 1313.4757 1313.3298 1313.4747 1313.2381 1313.2212 1313.3963 1313.4101 1313.4754 1313.2308 1313.3140 1313.3307 1313.5028 1313.3902 1313.3123 1313.2269 1313.4897 1313.2670 1313.4245 1313.5031 1313.2380 1313.4094 1313.2726 1313.4877 1313.3986 1313.4195 1313.2518 1313.4795 1313.2406 1313.4789 1313.2983 1313.4838 1313.2202 1313.2495 1313.4949 1313.4856 1313.4226 1313.2803 1313.2391 1313.2970 1313.2524 1313.3374 1313.3949 1313.3020 1313.4732 1313.3774 1313.3991 1313.2395 1313.4483 1313.4758 1313.5005 1313.4919 1313.2773 1313.2751 1313.2945 1313.4563 1313.2946 1313.4992 1313.2662 1313.3348 1313.2745 1313.2927 1313.2941 1313.4956 1313.2341 1313.5003 1313.4793 1313.3080 1313.2548 1313.3789 1313.2322 1313.2259 1313.2439 1313.4295 1313.3628 1313.3914 1313.3383 1313.2190 1313.3087 1313.2394 1313.2678 1313.4191 1313.4304 1313.4862 1313.3107 1313.2947 1313.3057 1313.4867 1313.2505 1313.2878 1313.2526 1313.3354 1313.3907 1313.2764 1313.2656 1313.3100 1313.4908 1313.2644 1313.4256 1313.3263 1313.3779 1313.2819 1313.4899 1313.3239 1313.2283 1313.2277 1313.3046 1313.4755 1313.4947 1313.2458 1313.2478 1313.3808 1313.2405 1313.4871 1313.2431 1313.2532 1313.3937 1313.2173 1313.4169 1313.2396 1313.4096 1313.3028 1313.4851 1313.3945 1313.4081 1313.2486 1313.4775 1313.2879 1313.2680 1313.4883 1313.3126 1313.4265 1313.2649 1313.4284 1313.2915 1313.4888 1313.4368 1313.2285 1313.2901 1313.2354 1313.5008 1313.3763 1313.2433 1313.2194 1313.2356 1313.3289 1313.3043 1313.2923 1313.4207 1313.3746 1313.2663 1313.3388 1313.2767 1313.4189 1313.2690 1313.2772 1313.2371 1313.2734 1313.4100 1313.4835 1313.2861 1313.2845 1313.2192 1313.4932 1313.2822 1313.2503 1313.4792 1313.4733 1313.3169 1313.3059 1313.2402 1313.4090 1313.4941 1313.2794 1313.3075 1313.2227 1313.2599 1313.4989 1313.2428 1313.4259 1313.4827 1313.4603 1313.3373 1313.3037 1313.4929 1313.2761 1313.3776 1313.3381 1313.2638 1313.3728 1313.3175 1313.4776 1313.3780 1313.3048 1313.4162 1313.2340 1313.3499 1313.3760 1313.4233 1313.2448 1313.4943 1313.4172 1313.4794 1313.2567 1313.3759 1313.4893 1313.3310 1313.4746 1313.2847 1313.2993 1313.3379 1313.3940 1313.4736 1313.2654 1313.3733 1313.5013 1313.5037 1313.2276 1313.2591 1313.2442 1313.4193 1313.4895 1313.2476 1313.3077 1313.3341 1313.3127 1313.2359 1313.2336 1313.4197 1313.3105 1313.4816 1313.5014 1313.2502 1313.5229 1313.3047 1313.3391 1313.4486 1313.2288 1313.4847 1313.4878 1313.2228 1313.2247 1313.4302 1313.2411 1313.2280 1313.5010 1313.3790 1313.2527 1313.2482 1313.3297 1313.2219 1313.3901 1313.2368 1313.3910 1313.4239 1313.3960 1313.2942 1313.2203 1313.2355 1313.2635 1313.3173 1313.2600 1313.5214 1313.2174 1313.4806 1313.3099 1313.2237 1313.2888 1313.2629 1313.3241 1313.3342 1313.2778 1313.2718 1313.4548 1313.2555 1313.2722 1313.2747 1313.2971 1313.2691 1313.2206 1313.3731 1313.4293 1313.3294 1313.2746 1313.3985 1313.4488 1313.2234 1313.4258 1313.4999 1313.2328 1313.4834 1313.2455 1313.4865 1313.4214 1313.2217 1313.2543 1313.3908 1313.4230 1313.2689 1313.4953 1313.2969 1313.2860 1313.3049 1313.3767 1313.2753 1313.2768 1313.2309 1313.2703 1313.3906 1313.3146 1313.5033 1313.4810 1313.2441 1313.2673 1313.2551 1313.2727 1313.2501 1313.3027 1313.2418 1313.2392 1313.5015 1313.2515 1313.2544 1313.4079 1313.4611 1313.2417 1313.4164 1313.4766 1313.3715 1313.2632 1313.4289 1313.2473 1313.2744 1313.5053 1313.3909 1313.2530 1313.2252 1313.3240 1313.2483 1313.4607 1313.4285 1313.2711 1313.2669 1313.2378 1313.2730 1313.4882 1313.4818 1313.2178 1313.2468 1313.4303 1313.3147 1313.3783 1313.4802 1313.2910 1313.4942 1313.3316 1313.3340 1313.2758 1313.4944 1313.2948 1313.4738 1313.4804 1313.3899 1313.2622 1313.3955 1313.2306 1313.4800 1313.4849 1313.2918 1313.4876 1313.3158 1313.2582 1313.3071 1313.2931 1313.4892 1313.4298 1313.2770 1313.2650 1313.4222 1313.3916 1313.3989 1313.4879 1313.4237 1313.3364 1313.4213 1313.2686 1313.2236 1313.3066 1313.2383 1313.4935 1313.4780 1313.4231 1313.2781 1313.2919 1313.4850 1313.3082 1313.2264 1313.3926 1313.2427 1313.2241 1313.4767 1313.2951 1313.2750 1313.2851 1313.4277 1313.4831 1313.4922 1313.2780 1313.3090 1313.2261 1313.3084 1313.3492 1313.4192 1313.2181 1313.2612 1313.3741 1313.3362 1313.5011 1313.3170 1313.4262 1313.2843 1313.4274 1313.2459 1313.2345 1313.3797 1313.2327 1313.4839 1313.3903 1313.3050 1313.4769 1313.4069 1313.2251 1313.4491 1313.4852 1313.4267 1313.4791 1313.3768 1313.2296 1313.4872 1313.3769 1313.4743 1313.3912 1313.3766 1313.2576 1313.4866 1313.2541 1313.2537 1313.3382 1313.3106 1313.4946 1313.5036 1313.4219 1313.2624 1313.3030 1313.3772 1313.3727 1313.3911 1313.4270 1313.3086 1313.2523 1313.2685 1313.2477 1313.2897 1313.3308 1313.3719 1313.2435 1313.2627 1313.2375 1313.2755 1313.4900 1313.4744 1313.4241 1313.2903 1313.2363 1313.3722 1313.2628 1313.2209 1313.2741 1313.3144 1313.2412 1313.2313 1313.3751 1313.2457 1313.3952 1313.4887 1313.2837 1313.3053 1313.4446 1313.2666 1313.3317 1313.3742 1313.2235 1313.4263 1313.4097 1313.2401 1313.2634 1313.4273 1313.4161 1313.2470 1313.2905 1313.3180 1313.4280 1313.2399 1313.2926 1313.4885 1313.2384 1313.4927 1313.4859 1313.3041 1313.2921 1313.2397 1313.2754 1313.3142 1313.2892 1313.4869 1313.3775 1313.4608 1313.2187 1313.2512 1313.2271 1313.2838 1313.2939 1313.3748 1313.4759 1313.4820 1313.2683 1313.4890 1313.2423 1313.3384 1313.4288 1313.2660 1313.4803 1313.2195 1313.2443 1313.2832 1313.2414 1313.4954 1313.3770 1313.3184 1313.2756 1313.2907 1313.4159 1313.2233 1313.2708 1313.2636 1313.5029 1313.3744 1313.2759 1313.3725 1313.2279 1313.2606 1313.3904 1313.3029 1313.4217 1313.2542 1313.2712 1313.4512 1313.3370 1313.5007 1313.2293 1313.2865 1313.3320 1313.2894 1313.2900 1313.3152 1313.2817 1313.2484 1313.3371 1313.2610 1313.2702 1313.4075 1313.3995 1313.2268 1313.2789 1313.2349 1313.2387 1313.2179 1313.2925 1313.2696 1313.4993 1313.4249 1313.2550 1313.2286 1313.4822 1313.4785 1313.3923 1313.2641 1313.3367 1313.4926 1313.2563 1313.2301 1313.3159 1313.3039 1313.2875 1313.2338 1313.2846 1313.2278 1313.4937 1313.4223 1313.4171 1313.4753 1313.3171 1313.2688 1313.2238 1313.3964 1313.3716 1313.2246 1313.3806 1313.3036 1313.4870 1313.4176 1313.2864 1313.2826 1313.4950 1313.4845 1313.2263 1313.4606 1313.4492 1313.3758 1313.2583 1313.4815 1313.2786 1313.2463 1313.3623 1313.2343 1313.2508 1313.2697 1313.2682 1313.4727 1313.2274 1313.3166 1313.4902 1313.4281 1313.4093 1313.2724 1313.2366 1313.2886 1313.4874 1313.4091 1313.3296 1313.2303 1313.3060 1313.4828 1313.2332 1313.5047 1313.2529 1313.3314 1313.2242 1313.2304 1313.3033 1313.3720 1313.3941 1313.2331 1313.3638 1313.3150 1313.2462 1313.2605 1313.4812 1313.3626 1313.4178 1313.2450 1313.2382 1313.3349 1313.4205 1313.2908 1313.3743 1313.4737 1313.3791 1313.3052 1313.4210 1313.4778 1313.3250 1313.5012 1313.2841 1313.3116 1313.2938 1313.2766 1313.3796 1313.2676 1313.5231 1313.2348 1313.2911 1313.2538 1313.2472 1313.2270 1313.2924 1313.4880 1313.4216 1313.4484 1313.2522 1313.2207 1313.2854 1313.2857 1313.2344 1313.4301 1313.2297 1313.4196 1313.2510 1313.4837 1313.4099 1313.4264 1313.2481 1313.2497 1313.2352 1313.2623 1313.2564 1313.2647 1313.2294 1313.4923 1313.2465 1313.2546 1313.4514 1313.2760 1313.4211 1313.2616 1313.3777 1313.2373 1313.2887 1313.2198 1313.2719 1313.4768 1313.2652 1313.2933 1313.3361 1313.4070 1313.3788 1313.2749 1313.3372 1313.2367 1313.2880 1313.2421 1313.2314 1313.2533 1313.3063 1313.3805 1313.3001 1313.2377 1313.4770 1313.3094 1313.4209 1313.2742 1313.4253 1313.4160 1313.2231 1313.3922 1313.2220 1313.2390 1313.2275 1313.2388 1313.2811 1313.4951 1313.4764 1313.4930 1313.2496 1313.2215 1313.3353 1313.2199 1313.4098 1313.3752 1313.2299 1313.5002 1313.2467 1313.3368 1313.2335 1313.2890 1313.4779 1313.2430 1313.4934 1313.2222 1313.2633 1313.3069 1313.2535 1313.4200 1313.4072 1313.4997 1313.4509 1313.3091 1313.2639 1313.3793 1313.3079 1313.3734 1313.2625 1313.4243 1313.3921 1313.2422 1313.3729 1313.5027 1313.3718 1313.3141 1313.3153 1313.2205 1313.2180 1313.2256 1313.3747 1313.2248 1313.4996 1313.4846 1313.2517 1313.2440 1313.3498 1313.4945 1313.2204 1313.4487 1313.2736 1313.2225 1313.2701 1313.3074 1313.2342 1313.2200 1313.4842 1313.4797 1313.2346';
147 :     $AdaboostValues{'Streptococcus pneumoniae'}{'beta-lactam'}{SUSCEPTIBLE} = '1313.3131 1313.4057 1313.2593 1313.5017 1313.3658 1313.4153 1313.3003 1313.5206 1313.3266 1313.2812 1313.3480 1313.3825 1313.4958 1313.5182 1313.3957 1313.3520 1313.4528 1313.3283 1313.5169 1313.4060 1313.4538 1313.5125 1313.5164 1313.3554 1313.4471 1313.5159 1313.4719 1313.2990 1313.3178 1313.3304 1313.4964 1313.5080 1313.2721 1313.4417 1313.3561 1313.4056 1313.5097 1313.3682 1313.5241 1313.3430 1313.4147 1313.5083 1313.4969 1313.4048 1313.3961 1313.4451 1313.5096 1313.3510 1313.4404 1313.4130 1313.4365 1313.4334 1313.5081 1313.4635 1313.3616 1313.2585 1313.4594 1313.2586 1313.5109 1313.3439 1313.4354 1313.3177 1313.4707 1313.4468 1313.4691 1313.4357 1313.3456 1313.5068 1313.4055 1313.4029 1313.3138 1313.4903 1313.5085 1313.3712 1313.2588 1313.5084 1313.4617 1313.4701 1313.4109 1313.4450 1313.4014 1313.5021 1313.2965 1313.5161 1313.4518 1313.3845 1313.2791 1313.3543 1313.2731 1313.3449 1313.4601 1313.4030 1313.4622 1313.5090 1313.5066 1313.3331 1313.4378 1313.5152 1313.3477 1313.2988 1313.3597 1313.3872 1313.3607 1313.4473 1313.4703 1313.2868 1313.3443 1313.3137 1313.4977 1313.3637 1313.4391 1313.3276 1313.3431 1313.3705 1313.3097 1313.3662 1313.4983 1313.4021 1313.3413 1313.3879 1313.3850 1313.4590 1313.5123 1313.3225 1313.2792 1313.4166 1313.5054 1313.3631 1313.2958 1313.4504 1313.4595 1313.4716 1313.3185 1313.5187 1313.5052 1313.3948 1313.4979 1313.2999 1313.5103 1313.4715 1313.4003 1313.5104 1313.3826 1313.5179 1313.2172 1313.5067 1313.5137 1313.4723 1313.4312 1313.4022 1313.5166 1313.4478 1313.3401 1313.5041 1313.3515 1313.4002 1313.3398 1313.3508 1313.5180 1313.5101 1313.2579 1313.5061 1313.5089 1313.5018 1313.3272 1313.3610 1313.4568 1313.3882 1313.4367 1313.5224 1313.3621 1313.4967 1313.4660 1313.5191 1313.3259 1313.5115 1313.3864 1313.3591 1313.3521 1313.3474 1313.4901 1313.4151 1313.4498 1313.4630 1313.4103 1313.3115 1313.4358 1313.4370 1313.4058 1313.4043 1313.3442 1313.4513 1313.3699 1313.4981 1313.4494 1313.4150 1313.4414 1313.3548 1313.3880 1313.4355 1313.5203 1313.2560 1313.5050 1313.3999 1313.4519 1313.3223 1313.4602 1313.4362 1313.4041 1313.4050 1313.3835 1313.5077 1313.3427 1313.3281 1313.3409 1313.3892 1313.5140 1313.5226 1313.3905 1313.4619 1313.4459 1313.4671 1313.3578 1313.3211 1313.4642 1313.3318 1313.2743 1313.3194 1313.4653 1313.4132 1313.4709 1313.3248 1313.5165 1313.4679 1313.3657 1313.5186 1313.4720 1313.3183 1313.3976 1313.4366 1313.3518 1313.5209 1313.3410 1313.3325 1313.3614 1313.4139 1313.3701 1313.3557 1313.3507 1313.3594 1313.3018 1313.3135 1313.4637 1313.3933 1313.5093 1313.4439 1313.4107 1313.5157 1313.3973 1313.4570 1313.3888 1313.4066 1313.4311 1313.2191 1313.4442 1313.5177 1313.5259 1313.5145 1313.3275 1313.4194 1313.3862 1313.4137 1313.4001 1313.4335 1313.3319 1313.4359 1313.4168 1313.3139 1313.4476 1313.5122 1313.3531 1313.3432 1313.4566 1313.4105 1313.5155 1313.4429 1313.3692 1313.3246 1313.3593 1313.4047 1313.3894 1313.3873 1313.3017 1313.5127 1313.4641 1313.3885 1313.4674 1313.3261 1313.3293 1313.5051 1313.3572 1313.3950 1313.4542 1313.4675 1313.4911 1313.4970 1313.2595 1313.2584 1313.4185 1313.5136 1313.4062 1313.3673 1313.3577 1313.3642 1313.4110 1313.4117 1313.4557 1313.4448 1313.4133 1313.4012 1313.4957 1313.3269 1313.3021 1313.4561 1313.3860 1313.2987 1313.4469 1313.5094 1313.3464 1313.4672 1313.3854 1313.4165 1313.4589 1313.3575 1313.4458 1313.3517 1313.4684 1313.5102 1313.4814 1313.3686 1313.3951 1313.3552 1313.5019 1313.4681 1313.4549 1313.3713 1313.4386 1313.4543 1313.5167 1313.3038 1313.3813 1313.2984 1313.3455 1313.2804 1313.4693 1313.4482 1313.5244 1313.3958 1313.3537 1313.4676 1313.5086 1313.5114 1313.4474 1313.4401 1313.4363 1313.4618 1313.5201 1313.4143 1313.4015 1313.4669 1313.4646 1313.4430 1313.2594 1313.3869 1313.3524 1313.3881 1313.3329 1313.3589 1313.5163 1313.2963 1313.3436 1313.3136 1313.5234 1313.4621 1313.4692 1313.3402 1313.3007 1313.3542 1313.3187 1313.5243 1313.3969 1313.5088 1313.4553 1313.4560 1313.3924 1313.4182 1313.4067 1313.3016 1313.5124 1313.4633 1313.3547 1313.3694 1313.4024 1313.4546 1313.5045 1313.4188 1313.2991 1313.3649 1313.5118 1313.3890 1313.4638 1313.2807 1313.3565 1313.4573 1313.3244 1313.5197 1313.5020 1313.3821 1313.4323 1313.5217 1313.3193 1313.5130 1313.3827 1313.3648 1313.4463 1313.4032 1313.4647 1313.4383 1313.4502 1313.3533 1313.4580 1313.2740 1313.4627 1313.5132 1313.3819 1313.3667 1313.3514 1313.5185 1313.4541 1313.4555 1313.3190 1313.4722 1313.4600 1313.3221 1313.5249 1313.4551 1313.3689 1313.3399 1313.4700 1313.3672 1313.4008 1313.3896 1313.2816 1313.3375 1313.4572 1313.3338 1313.5129 1313.4005 1313.3026 1313.5256 1313.3122 1313.4643 1313.2805 1313.5219 1313.3378 1313.4496 1313.4501 1313.3277 1313.3133 1313.3199 1313.3230 1313.3446 1313.3707 1313.4537 1313.3279 1313.3260 1313.3300 1313.4912 1313.3837 1313.3878 1313.3415 1313.3479 1313.4121 1313.2725 1313.4111 1313.3210 1313.4010 1313.5144 1313.5116 1313.5095 1313.4006 1313.4061 1313.5025 1313.5062 1313.3332 1313.4406 1313.4455 1313.4598 1313.3523 1313.4385 1313.4174 1313.5043 1313.3429 1313.2717 1313.4571 1313.2776 1313.4651 1313.4470 1313.4917 1313.4511 1313.3278 1313.2801 1313.5049 1313.4982 1313.4547 1313.3842 1313.2596 1313.5250 1313.3849 1313.4427 1313.3982 1313.4051 1313.5247 1313.3604 1313.4821 1313.3489 1313.4053 1313.4350 1313.5189 1313.5246 1313.5023 1313.4309 1313.4559 1313.4554 1313.4655 1313.4579 1313.5035 1313.4961 1313.2799 1313.3836 1313.3008 1313.4682 1313.2989 1313.3822 1313.3696 1313.3863 1313.2825 1313.2981 1313.5024 1313.3987 1313.3229 1313.4424 1313.3983 1313.4615 1313.5022 1313.4591 1313.3693 1313.4639 1313.3567 1313.4394 1313.4972 1313.4341 1313.3333 1313.2729 1313.4127 1313.4122 1313.3132 1313.3859 1313.3235 1313.4320 1313.3460 1313.4461 1313.4984 1313.3539 1313.4680 1313.3685 1313.4668 1313.3224 1313.3666 1313.3506 1313.4431 1313.3400 1313.4146 1313.4033 1313.3216 1313.4379 1313.3476 1313.5105 1313.4584 1313.4118 1313.4914 1313.3823 1313.3630 1313.2953 1313.2957 1313.3113 1313.2793 1313.2797 1313.4113 1313.3394 1313.3200 1313.3646 1313.4962 1313.4686 1313.4694 1313.5079 1313.3855 1313.2590 1313.3655 1313.4116 1313.3009 1313.4411 1313.3568 1313.3580 1313.3558 1313.5057 1313.4381 1313.4126 1313.4390 1313.3641 1313.5232 1313.3942 1313.3871 1313.4508 1313.5107 1313.3608 1313.4418 1313.3550 1313.5223 1313.4443 1313.3453 1313.3664 1313.3061 1313.4698 1313.4632 1313.5148 1313.4125 1313.3055 1313.2956 1313.4004 1313.4576 1313.2364 1313.3355 1313.3828 1313.3981 1313.5174 1313.4336 1313.3505 1313.3470 1313.4052 1313.3448 1313.4666 1313.3416 1313.4382 1313.3661 1313.5139 1313.4500 1313.3205 1313.4447 1313.4037 1313.3861 1313.2828 1313.4011 1313.4480 1313.3189 1313.4452 1313.3587 1313.3181 1313.4388 1313.4353 1313.4433 1313.3569 1313.4702 1313.5147 1313.4387 1313.3540 1313.4705 1313.3262 1313.3405 1313.4039 1313.4636 1313.3103 1313.3326 1313.3815 1313.3407 1313.5190 1313.3891 1313.5242 1313.4405 1313.5078 1313.3327 1313.4331 1313.5117 1313.3002 1313.3612 1313.5026 1313.3895 1313.4477 1313.5039 1313.4114 1313.5142 1313.4108 1313.4407 1313.3830 1313.5251 1313.3522 1313.4718 1313.4119 1313.4025 1313.4527 1313.4624 1313.5181 1313.4915 1313.3254 1313.5071 1313.2715 1313.4696 1313.5225 1313.4658 1313.4059 1313.3884 1313.3422 1313.3954 1313.4145 1313.3397 1313.4599 1313.3585 1313.3393 1313.3586 1313.3866 1313.4444 1313.4377 1313.4697 1313.3874 1313.3228 1313.4499 1313.3690 1313.2966 1313.3363 1313.3280 1313.3611 1313.4690 1313.3291 1313.4545 1313.4683 1313.4398 1313.4975 1313.5069 1313.4445 1313.3258 1313.4324 1313.4409 1313.2967 1313.5098 1313.5202 1313.5238 1313.3303 1313.4393 1313.3677 1313.3529 1313.3292 1313.3425 1313.4667 1313.2962 1313.3222 1313.5134 1313.5204 1313.5106 1313.3615 1313.3418 1313.3919 1313.4721 1313.2808 1313.3463 1313.5183 1313.3967 1313.4649 1313.4027 1313.4704 1313.3570 1313.3108 1313.4656 1313.2960 1313.5154 1313.4525 1313.3179 1313.2580 1313.3946 1313.4325 1313.5108 1313.3811 1313.4064 1313.4345 1313.2720 1313.3893 1313.3186 1313.2189 1313.4677 1313.3663 1313.3688 1313.3603 1313.3233 1313.4724 1313.4913 1313.3345 1313.5100 1313.3656 1313.5168 1313.5138 1313.5064 1313.4959 1313.3617 1313.3192 1313.5195 1313.3213 1313.3334 1313.4063 1313.5210 1313.3602 1313.4426 1313.4711 1313.3588 1313.3454 1313.2977 1313.4535 1313.2714 1313.4661 1313.3219 1313.3282 1313.4529 1313.3344 1313.3601 1313.4016 1313.3411 1313.3856 1313.3634 1313.4045 1313.4550 1313.4986 1313.3117 1313.3270 1313.2575 1313.3469 1313.4428 1313.4374 1313.2976 1313.4046 1313.4481 1313.3697 1313.4526 1313.3618 1313.5113 1313.4556 1313.4224 1313.5076 1313.3831 1313.5248 1313.3867 1313.4987 1313.3998 1313.4523 1313.4042 1313.2802 1313.3583 1313.5255 1313.5237 1313.4464 1313.2813 1313.3196 1313.4348 1313.4536 1313.4310 1313.3668 1313.4544 1313.5150 1313.4670 1313.3128 1313.4449 1313.4339 1313.4587 1313.2739 1313.4530 1313.4673 1313.4179 1313.2867 1313.3870 1313.4073 1313.3708 1313.3218 1313.4678 1313.5058 1313.5070 1313.4344 1313.3273 1313.4516 1313.4013 1313.3644 1313.3818 1313.4399 1313.4333 1313.3841 1313.4604 1313.5074 1313.4342 1313.4326 1313.3679 1313.3377 1313.3527 1313.3025 1313.3295 1313.3182 1313.4708 1313.4054 1313.3472 1313.4472 1313.3227 1313.4123 1313.3997 1313.4416 1313.3654 1313.3212 1313.3541 1313.2996 1313.3582 1313.3112 1313.3581 1313.3466 1313.4436 1313.5143 1313.4369 1313.3820 1313.5135 1313.3396 1313.4507 1313.3451 1313.3645 1313.5158 1313.4965 1313.3669 1313.2831 1313.3109 1313.4910 1313.4154 1313.2239 1313.5119 1313.3545 1313.3290 1313.3249 1313.5200 1313.4581 1313.4131 1313.4663 1313.3412 1313.2852 1313.4124 1313.3678 1313.2723 1313.5153 1313.4644 1313.3285 1313.2574 1313.5126 1313.5245 1313.4585 1313.4031 1313.4597 1313.3452 1313.2994 1313.4402 1313.3217 1313.3711 1313.3536 1313.3576 1313.3564 1313.4808 1313.4023 1313.3687 1313.3566 1313.3195 1313.3605 1313.3538 1313.4980 1313.4960 1313.4026 1313.5196 1313.3356 1313.4966 1313.3201 1313.4689 1313.3462 1313.2853 1313.4916 1313.4616 1313.5072 1313.3709 1313.3493 1313.4183 1313.2827 1313.3966 1313.4190 1313.3023 1313.3206 1313.4665 1313.3111 1313.2955 1313.4688 1313.4971 1313.3426 1313.4955 1313.3447 1313.5236 1313.5254 1313.2858 1313.4588 1313.2800 1313.4338 1313.3019 1313.4695 1313.3056 1313.5038 1313.5176 1313.4809 1313.4976 1313.3444 1313.5120 1313.4044 1313.5099 1313.3010 1313.4106 1313.3004 1313.5207 1313.3392 1313.3551 1313.3512 1313.3846 1313.3343 1313.5192 1313.3674 1313.3408 1313.3423 1313.3130 1313.5149 1313.4148 1313.4115 1313.3435 1313.4457 1313.3022 1313.5173 1313.4454 1313.3629 1313.4629 1313.3328 1313.4144 1313.2578 1313.3468 1313.4467 1313.4036 1313.4313 1313.4423 1313.3573 1313.4626 1313.3404 1313.4184 1313.3571 1313.4330 1313.2821 1313.4628 1313.3559 1313.4322 1313.3975 1313.3403 1313.4577 1313.3207 1313.4562 1313.4065 1313.5063 1313.2972 1313.2959 1313.4552 1313.5193 1313.3660 1313.4373 1313.4136 1313.3011 1313.3202 1313.4438 1313.4351 1313.4134 1313.4558 1313.3471 1313.4495 1313.2980 1313.3198 1313.3843 1313.3324 1313.4517 1313.3698 1313.3265 1313.4315 1313.4620 1313.3683 1313.3832 1313.4009 1313.4662 1313.3014 1313.4422 1313.4985 1313.3434 1313.5233 1313.5239 1313.4717 1313.3504 1313.4167 1313.3450 1313.4918 1313.4343 1313.3834 1313.3134 1313.3652 1313.4564 1313.4574 1313.5042 1313.3271 1313.4963 1313.4104 1313.3600 1313.4567 1313.3215 1313.3639 1313.3220 1313.3931 1313.3671 1313.4371 1313.3640 1313.3887 1313.3934 1313.5172 1313.3824 1313.4575 1313.3478 1313.4129 1313.5216 1313.4540 1313.3457 1313.2824 1313.2954 1313.3102 1313.2815 1313.3844 1313.4337 1313.3877 1313.3680 1313.3546 1313.4376 1313.2738 1313.3943 1313.4462 1313.3129 1313.3534 1313.4019 1313.5178 1313.3209 1313.4372 1313.4532 1313.4968 1313.3420 1313.5240 1313.3886 1313.4017 1313.3234 1313.4317 1313.4659 1313.4419 1313.4018 1313.3851 1313.4112 1313.5146 1313.4539 1313.3848 1313.3305 1313.4384 1313.3208 1313.4645 1313.4135 1313.4593 1313.4522 1313.3528 1313.3544 1313.3513 1313.3868 1313.3599 1313.3706 1313.5260 1313.4396 1313.4524 1313.2975 1313.4699 1313.3321 1313.4329 1313.3419 1313.5171 1313.4319 1313.4974 1313.5059 1313.4049 1313.3012 1313.5092 1313.2592 1313.4713 1313.3595 1313.3322 1313.4340 1313.3191 1313.3417 1313.5056 1313.4864 1313.2809 1313.2814 1313.3875 1313.3635 1313.4534 1313.3695 1313.5215 1313.4714 1313.4664 1313.3421 1313.4028 1313.3609 1313.3252 1313.3395 1313.5208 1313.3555 1313.3494 1313.3006 1313.3853 1313.5235 1313.3428 1313.2961 1313.4510 1313.4465 1313.3302 1313.2716 1313.3596 1313.3226 1313.3347 1313.3118 1313.5040 1313.3636 1313.3714 1313.4142 1313.3054 1313.4654 1313.3710 1313.2581 1313.4712 1313.4521 1313.3675 1313.5258 1313.4425 1313.4040 1313.3509 1313.3013 1313.4038 1313.3437 1313.3473 1313.2823 1313.3622 1313.3467 1313.4364 1313.4403 1313.4173 1313.3556 1313.4586 1313.2577 1313.4687 1313.5211 1313.3519 1313.3938 1313.3098 1313.2810 1313.3647 1313.3816 1313.4640 1313.3974 1313.4007 1313.4569 1313.4648 1313.3188 1313.3562 1313.3809 1313.5194 1313.4657 1313.4592 1313.3114 1313.4710 1313.4034 1313.4332 1313.4420 1313.2856 1313.3337 1313.3691 1313.4163 1313.3653 1313.3817 1313.5065 1313.4475 1313.4068 1313.3335 1313.3268 1313.4141 1313.4652 1313.5160 1313.5110 1313.3847 1313.5133 1313.5131 1313.3814 1313.5121 1313.3606 1313.4634 1313.4453 1313.5044 1313.3433 1313.4578 1313.4020 1313.3482 1313.4360 1313.3256 1313.4817 1313.3858 1313.5060 1313.4479 1313.3549 1313.5252 1313.2589 1313.3000 1313.4582 1313.4120 1313.3659 1313.3438 1313.5030 1313.3876 1313.3702 1313.4434 1313.4533 1313.3592 1313.2713 1313.3681 1313.3214 1313.4596 1313.3440 1313.3838 1313.4440 1313.3932 1313.3406 1313.5205 1313.3883 1313.5184 1313.4685 1313.3972 1313.4583 1313.3613 1313.4466 1313.4347 1313.4978 1313.3632 1313.5112 1313.3620 1313.3970 1313.3619 1313.3665 1313.3670 1313.3651 1313.4973 1313.3563 1313.3516 1313.4413 1313.4614 1313.4506 1313.4149 1313.5111 1313.4000 1313.3481 1313.5075 1313.4623 1313.4565 1313.3197 1313.2572 1313.4314 1313.3458 1313.3650 1313.3700 1313.2790 1313.3255 1313.3024 1313.3676 1313.3204 1313.5221 1313.3088 1313.5257 1313.3495 1313.4140 1313.3560 1313.3501 1313.3465 1313.3530 1313.3532 1313.3360 1313.5198 1313.3511 1313.4520 1313.5073 1313.4327 1313.3237 1313.5175 1313.3525 1313.5199 1313.2806 1313.3461 1313.4321 1313.2982 1313.4497 1313.3590 1313.3574 1313.2835 1313.4531 1313.5213 1313.4505 1313.4706 1313.3889 1313.2973 1313.5170 1313.4361 1313.4441 1313.3414 1313.3865 1313.4181 1313.3810 1313.3633 1313.4435 1313.4503 1313.3833 1313.4152 1313.4456 1313.4395 1313.4328 1313.4515 1313.5253 1313.3947 1313.4352 1313.3110 1313.3953 1313.4035 1313.5162 1313.5091 1313.4380 1313.3284 1313.4138 1313.4421 1313.4400 1313.4437 1313.4432 1313.5055 1313.4318 1313.3704 1313.3503 1313.3203 1313.3231 1313.5151 1313.5087 1313.3703 1313.3424 1313.3526 1313.4650 1313.3459 1313.4128 1313.3839 1313.3840 1313.3553 1313.3253 1313.5222 1313.3852 1313.4460 1313.5141 1313.3336 1313.3598 1313.2995 1313.5082 1313.4408 1313.4088 1313.3323 1313.4187 1313.5128 1313.5220 1313.3359 1313.3584 1313.5188 1313.4625 1313.4177 1313.4392 1313.3857 1313.3928 1313.3579 1313.4631';
148 :     $AdaboostValues{'Streptococcus pneumoniae'}{'beta-lactam'}{AUC} = '0.971';
149 :     $AdaboostValues{'Streptococcus pneumoniae'}{'beta-lactam'}{F1} = '0.907';
150 :     $AdaboostValues{'Streptococcus pneumoniae'}{'beta-lactam'}{ACCURACY} = '0.909';
151 :     $AdaboostValues{'Streptococcus pneumoniae'}{'beta-lactam'}{SOURCES} = 'PMID: 24509479; PMID: 25101644';
152 :     $AdaboostValues{'Streptococcus pneumoniae'}{'beta-lactam'}{FUNCTION} = 'Beta-lactam resistance predicted region';
153 :    
154 :    
155 :     # co-trimoxazole
156 :    
157 :     $AdaboostValues{'Streptococcus pneumoniae'}{'co-trimoxazole'}{ANTIBIOTICS} = 'co-trimoxazole trimethoprim/sulfamethoxazole';
158 :     $AdaboostValues{'Streptococcus pneumoniae'}{'co-trimoxazole'}{ABBREVIATIONS} = 'SXT';
159 :    
160 :     my $SP_SXT = <<"End_of_SP_SXT";
161 :     0.660607 TTATTTCTCTATTTTACCATAAAAAGAAAAA CATATTATTTCTCTATTTTACCATAAAAAGA ATATTATTTCTCTATTTTACCATAAAAAGAA ATTATTTCTCTATTTTACCATAAAAAGAAAA TATTATTTCTCTATTTTACCATAAAAAGAAA
162 :     0.553123 AAATAGGTATCTCCCTCCACCCGAGCATGAA AATAGGTATCTCCCTCCACCCGAGCATGAAT
163 :     0.506334 CAAAAATCCATTCACTTTGAGCTTTAGAACC GTTCTAAAGCTCAAAGTGAATGGATTTTTGA AAAATCCATTCACTTTGAGCTTTAGAACCAT AATCCATTCACTTTGAGCTTTAGAACCATCA AAAAATCCATTCACTTTGAGCTTTAGAACCA AAATCCATTCACTTTGAGCTTTAGAACCATC
164 :     0.38645 GCTGGACTCAGTTCTTTCCAGTCAACTAGAC AGCTGGACTCAGTTCTTTCCAGTCAACTAGA
165 :     0.349196 TTCTGCTCAAAAATAGAGTTGAAGCATAAAA
166 :     0.362451 AGAACTTGGACAAGCACCTGGTTTGTAAGAA CTTACAAACCAGGTGCTTGTCCAAGTTCTGC CAGAACTTGGACAAGCACCTGGTTTGTAAGA
167 :     0.37391 AAATTAGAATTCTGTTAAAAAAAATGATATA TATCATTTTTTTTAACAGAATTCTAATTTCA GATGAAATTAGAATTCTGTTAAAAAAAATGA AATTAGAATTCTGTTAAAAAAAATGATATAA ATCATTTTTTTTAACAGAATTCTAATTTCAT ATATCATTTTTTTTAACAGAATTCTAATTTC
168 :     0.306115 AGATGAGGACATCACTTTCCTTGCGAATAGC CTATTCGCAAGGAAAGTGATGTCCTCATCTC AGAGATGAGGACATCACTTTCCTTGCGAATA
169 :     0.299797 ATATCATTCAAGACACCGCCACAACCAAGGG
170 :     0.270102 AACCCAGTCACCACCGATATTGCCACCTTCA AAGGTGGCAATATCGGTGGTGACTGGGTTAT GCAATATCGGTGGTGACTGGGTTATCCAAAA AATATCGGTGGTGACTGGGTTATCCAAAAGA ACCCAGTCACCACCGATATTGCCACCTTCAA TGGCAATATCGGTGGTGACTGGGTTATCCAA TATCGGTGGTGACTGGGTTATCCAAAAGAAA GGCAATATCGGTGGTGACTGGGTTATCCAAA GAAGGTGGCAATATCGGTGGTGACTGGGTTA CAATATCGGTGGTGACTGGGTTATCCAAAAG AGGTGGCAATATCGGTGGTGACTGGGTTATC TCGGTGGTGACTGGGTTATCCAAAAGAAAGA GGATAACCCAGTCACCACCGATATTGCCACC ATCGGTGGTGACTGGGTTATCCAAAAGAAAG GTGGCAATATCGGTGGTGACTGGGTTATCCA CCCAGTCACCACCGATATTGCCACCTTCAAA ATATCGGTGGTGACTGGGTTATCCAAAAGAA
171 :     End_of_SP_SXT
172 :    
173 :     my %load = &Load_Adaboost ($SP_SXT);
174 :     $AdaboostValues{'Streptococcus pneumoniae'}{'co-trimoxazole'}{ADABOOST} = \%load;
175 :     $AdaboostValues{'Streptococcus pneumoniae'}{'co-trimoxazole'}{RESISTANT} = '1313.4386 1313.3781 1313.2408 1313.2562 1313.4196 1313.4274 1313.2792 1313.3175 1313.2356 1313.4992 1313.2798 1313.4861 1313.2484 1313.3371 1313.3155 1313.2683 1313.3345 1313.3375 1313.4242 1313.2385 1313.4455 1313.4727 1313.3891 1313.2770 1313.4770 1313.2314 1313.5150 1313.5005 1313.4811 1313.2366 1313.3386 1313.3205 1313.4218 1313.3731 1313.2174 1313.3376 1313.3333 1313.3348 1313.3773 1313.3028 1313.4791 1313.2317 1313.3325 1313.2508 1313.2629 1313.3079 1313.2389 1313.4207 1313.3053 1313.3120 1313.2510 1313.2989 1313.2776 1313.2984 1313.3286 1313.3369 1313.2517 1313.5235 1313.2631 1313.3340 1313.4306 1313.3840 1313.3626 1313.4210 1313.5176 1313.2305 1313.3268 1313.2175 1313.2633 1313.2318 1313.2892 1313.3652 1313.2532 1313.3059 1313.4508 1313.4251 1313.4755 1313.4070 1313.4774 1313.4773 1313.4176 1313.5013 1313.2773 1313.5006 1313.4373 1313.2795 1313.2850 1313.4916 1313.4917 1313.2344 1313.2293 1313.3946 1313.3094 1313.4822 1313.3008 1313.2739 1313.2974 1313.3370 1313.4438 1313.3035 1313.4982 1313.4278 1313.4066 1313.4447 1313.5183 1313.3525 1313.3024 1313.3918 1313.2969 1313.4496 1313.2702 1313.3993 1313.3341 1313.4269 1313.4905 1313.2299 1313.2762 1313.2924 1313.3234 1313.2214 1313.4183 1313.3723 1313.3156 1313.3036 1313.3060 1313.4784 1313.4987 1313.3748 1313.2914 1313.2342 1313.5224 1313.2338 1313.3099 1313.2729 1313.2412 1313.4606 1313.3141 1313.2564 1313.5016 1313.3002 1313.2777 1313.4960 1313.2311 1313.5012 1313.5071 1313.2546 1313.5046 1313.2832 1313.3522 1313.4272 1313.2295 1313.3144 1313.5120 1313.3462 1313.4925 1313.4878 1313.4844 1313.4055 1313.2415 1313.5131 1313.3091 1313.3961 1313.2680 1313.2864 1313.3955 1313.2722 1313.2982 1313.2567 1313.2268 1313.2432 1313.3229 1313.3338 1313.2888 1313.4840 1313.3588 1313.3087 1313.2476 1313.3901 1313.2557 1313.3899 1313.2226 1313.4857 1313.2677 1313.3147 1313.2672 1313.3541 1313.4024 1313.2684 1313.2873 1313.2910 1313.2453 1313.3862 1313.2807 1313.2493 1313.3836 1313.4423 1313.4056 1313.5159 1313.2279 1313.4780 1313.2451 1313.3798 1313.3266 1313.2519 1313.4428 1313.3904 1313.2623 1313.3999 1313.3627 1313.3735 1313.4890 1313.3126 1313.3892 1313.4903 1313.3003 1313.5039 1313.2979 1313.3138 1313.4514 1313.4740 1313.4820 1313.2327 1313.2401 1313.3212 1313.2487 1313.2707 1313.5218 1313.3385 1313.2658 1313.2959 1313.3683 1313.2628 1313.3152 1313.5206 1313.2583 1313.2255 1313.2512 1313.3517 1313.2504 1313.4816 1313.3879 1313.2496 1313.2287 1313.4847 1313.3790 1313.4410 1313.2382 1313.2482 1313.3347 1313.2369 1313.2918 1313.3607 1313.2579 1313.3772 1313.3289 1313.4788 1313.3068 1313.4027 1313.4824 1313.3116 1313.2876 1313.2372 1313.3081 1313.2816 1313.2922 1313.2943 1313.4097 1313.4807 1313.2878 1313.4364 1313.3405 1313.2839 1313.5167 1313.2402 1313.2231 1313.3034 1313.3854 1313.2930 1313.3016 1313.3452 1313.3900 1313.2270 1313.3605 1313.3244 1313.3366 1313.3802 1313.2230 1313.4211 1313.2536 1313.2826 1313.4990 1313.3779 1313.4781 1313.4304 1313.4777 1313.2757 1313.4177 1313.3506 1313.2411 1313.2928 1313.4221 1313.3910 1313.4351 1313.4764 1313.5166 1313.4845 1313.4749 1313.3158 1313.4300 1313.3298 1313.3752 1313.4775 1313.2199 1313.3277 1313.3049 1313.4980 1313.3950 1313.2731 1313.4228 1313.3135 1313.4065 1313.3365 1313.4252 1313.3308 1313.3849 1313.3086 1313.3590 1313.2774 1313.3368 1313.3550 1313.5241 1313.2778 1313.3839 1313.3775 1313.3058 1313.3040 1313.2516 1313.2575 1313.4413 1313.4942 1313.3903 1313.3140 1313.2909 1313.2950 1313.3131 1313.5040 1313.5108 1313.4130 1313.2720 1313.4750 1313.2254 1313.5133 1313.2186 1313.2622 1313.2472 1313.4289 1313.3310 1313.3917 1313.2238 1313.2624 1313.2518 1313.3294 1313.4161 1313.4834 1313.2647 1313.2759 1313.4484 1313.4086 1313.4305 1313.3921 1313.2611 1313.2574 1313.3923 1313.2601 1313.4098 1313.2665 1313.5010 1313.4165 1313.2921 1313.3332 1313.3093 1313.2515 1313.3873 1313.2917 1313.3720 1313.2870 1313.2473 1313.3184 1313.2494 1313.4497 1313.4010 1313.3231 1313.2745 1313.2942 1313.3014 1313.2273 1313.2346 1313.4330 1313.3057 1313.2726 1313.2834 1313.4881 1313.2652 1313.3344 1313.4918 1313.5204 1313.3714 1313.2865 1313.4307 1313.5042 1313.4814 1313.3162 1313.2686 1313.2945 1313.3110 1313.5134 1313.5203 1313.5240 1313.2439 1313.2823 1313.3223 1313.3935 1313.2903 1313.2767 1313.4253 1313.3608 1313.4032 1313.2887 1313.2397 1313.3876 1313.2440 1313.3056 1313.2645 1313.2337 1313.2585 1313.2949 1313.3725 1313.2874 1313.4191 1313.5184 1313.3951 1313.3576 1313.3166 1313.4974 1313.4229 1313.2899 1313.4451 1313.2582 1313.2522 1313.3219 1313.4888 1313.2975 1313.2632 1313.2355 1313.3548 1313.4328 1313.4128 1313.2872 1313.2291 1313.2410 1313.2353 1313.2941 1313.4076 1313.3104 1313.3719 1313.3039 1313.4609 1313.2237 1313.5154 1313.4935 1313.5243 1313.2679 1313.4182 1313.4498 1313.2224 1313.3881 1313.2730 1313.4920 1313.4301 1313.3111 1313.4470 1313.2956 1313.2218 1313.2292 1313.2843 1313.4053 1313.5125 1313.3160 1313.3172 1313.2404 1313.2422 1313.4487 1313.4798 1313.4230 1313.4778 1313.2386 1313.3860 1313.4072 1313.2937 1313.5124 1313.2691 1313.3638 1313.4356 1313.2323 1313.2319 1313.4178 1313.5196 1313.2712 1313.3867 1313.2602 1313.2570 1313.2471 1313.2326 1313.2456 1313.4842 1313.3210 1313.3230 1313.4270 1313.3288 1313.2253 1313.2542 1313.2612 1313.3199 1313.2469 1313.5112 1313.4282 1313.4237 1313.4094 1313.2711 1313.4195 1313.4073 1313.2468 1313.4996 1313.4995 1313.2972 1313.2670 1313.2374 1313.3507 1313.4838 1313.3117 1313.2787 1313.2423 1313.2350 1313.3786 1313.2821 1313.4848 1313.4833 1313.4611 1313.3749 1313.3780 1313.3236 1313.3552 1313.2197 1313.4782 1313.3276 1313.3758 1313.3020 1313.2708 1313.5149 1313.2651 1313.2782 1313.4201 1313.4012 1313.2458 1313.2549 1313.3977 1313.3680 1313.3738 1313.5198 1313.3018 1313.2538 1313.3281 1313.2424 1313.4828 1313.2416 1313.3189 1313.4200 1313.2668 1313.3258 1313.3893 1313.2196 1313.2598 1313.2830 1313.3960';
176 :     $AdaboostValues{'Streptococcus pneumoniae'}{'co-trimoxazole'}{SUSCEPTIBLE} = '1313.5057 1313.3634 1313.4597 1313.3526 1313.3422 1313.4435 1313.4565 1313.5030 1313.4481 1313.3482 1313.5093 1313.3407 1313.2797 1313.5058 1313.4883 1313.3444 1313.4743 1313.4569 1313.4359 1313.3413 1313.4574 1313.3474 1313.4625 1313.4645 1313.4723 1313.4318 1313.3965 1313.4650 1313.4314 1313.3663 1313.4528 1313.3519 1313.3515 1313.4627 1313.4703 1313.4699 1313.4480 1313.3924 1313.3448 1313.3453 1313.5078 1313.3509 1313.3390 1313.3353 1313.4340 1313.4665 1313.4535 1313.3529 1313.4404 1313.3303 1313.4664 1313.4753 1313.4601 1313.4911 1313.3431 1313.4694 1313.4680 1313.4666 1313.3631 1313.3675 1313.5070 1313.3302 1313.4119 1313.4579 1313.4705 1313.4589 1313.3568 1313.4358 1313.3990 1313.4696 1313.4104 1313.5089 1313.4766 1313.4654 1313.3433 1313.2803 1313.5094 1313.3562 1313.4403 1313.4669 1313.4129 1313.4684 1313.4406 1313.3615 1313.4591 1313.4394 1313.3571 1313.4660 1313.3976 1313.3114 1313.3304 1313.3989 1313.4473 1313.3434 1313.4731 1313.3603 1313.3612 1313.3934 1313.4687 1313.4717 1313.3611 1313.3491 1313.3416 1313.3636 1313.4566 1313.3354 1313.3811 1313.4758 1313.3472 1313.3465 1313.4103 1313.3414 1313.4430 1313.4594 1313.3356 1313.2856 1313.2853 1313.3488 1313.5230 1313.4372 1313.4716 1313.4691 1313.3597 1313.3391 1313.4320 1313.4109 1313.3260 1313.4702 1313.4383 1313.4809 1313.3967 1313.4111 1313.5056 1313.3411 1313.2193 1313.4561 1313.4370 1313.2859 1313.4396 1313.4821 1313.2180 1313.4697 1313.3630 1313.4592 1313.4738 1313.4659 1313.4121 1313.4362 1313.4384 1313.4116 1313.4662 1313.3435 1313.4344 1313.3969 1313.3664 1313.4026 1313.4321 1313.4580 1313.4657 1313.5077 1313.4432 1313.4439 1313.3613 1313.4319 1313.3941 1313.5038 1313.3658 1313.4381 1313.4588 1313.4118 1313.4106 1313.4595 1313.3530 1313.3410 1313.4398 1313.3697 1313.4048 1313.3139 1313.4317 1313.4525 1313.4674 1313.4312 1313.3816 1313.4108 1313.4671 1313.5084 1313.3402 1313.5099 1313.3622 1313.5253 1313.3695 1313.3808 1313.4482 1313.4387 1313.3701 1313.3301 1313.3693 1313.3531 1313.3299 1313.3660 1313.3418 1313.5048 1313.2861 1313.3685 1313.4685 1313.3712 1313.2860 1313.3423 1313.4401 1313.3451 1313.2763 1313.2239 1313.4642 1313.4533 1313.3450 1313.3674 1313.4672 1313.3642 1313.4382 1313.5026 1313.3662 1313.5073 1313.4380 1313.4573 1313.4692 1313.4640 1313.2902 1313.4555 1313.5061 1313.4712 1313.4125 1313.4707 1313.3690 1313.3982 1313.3942 1313.4363 1313.3514 1313.3646 1313.4123 1313.4311 1313.3430 1313.3459 1313.3694 1313.4361 1313.4560 1313.4693 1313.3933 1313.4001 1313.4653 1313.4676 1313.3569 1313.3866 1313.3598 1313.5098 1313.3812 1313.3645 1313.5219 1313.4598 1313.4663 1313.4408 1313.3610 1313.3539 1313.5054 1313.3889 1313.3639 1313.3429 1313.5109 1313.4646 1313.3988 1313.3438 1313.4658 1313.4117 1313.4549 1313.3408 1313.4620 1313.4714 1313.5052 1313.3698 1313.4638 1313.4339 1313.3567 1313.3357 1313.3595 1313.4395 1313.3708 1313.5051 1313.4599 1313.4675 1313.3601 1313.4656 1313.3427 1313.4720 1313.4578 1313.3633 1313.4761 1313.3673 1313.3890 1313.5019 1313.3468 1313.4633 1313.3702 1313.3119 1313.5227 1313.4334 1313.4715 1313.4115 1313.5037 1313.3991 1313.3492 1313.4700 1313.4689 1313.3352 1313.4688 1313.5055 1313.4374 1313.3810 1313.3705 1313.4617 1313.4584 1313.4706 1313.4388 1313.3620 1313.3271 1313.4376 1313.4476 1313.3678 1313.3814 1313.4629 1313.4938 1313.3619 1313.3518 1313.5025 1313.4107 1313.3629 1313.3614 1313.4686 1313.3415 1313.3570 1313.4324 1313.4399 1313.4582 1313.4550 1313.3218 1313.3350 1313.4568 1313.4634 1313.4322 1313.3672 1313.3565 1313.3997 1313.4948 1313.3478 1313.3428 1313.3644 1313.4369 1313.3188 1313.4621 1313.5020 1313.3559 1313.3470 1313.2215 1313.3421 1313.2857 1313.5076 1313.4520 1313.3436 1313.3561 1313.2211 1313.3938 1313.3830 1313.3981 1313.4004 1313.3975 1313.5231 1313.3425 1313.3871 1313.3297 1313.3699 1313.3599 1313.4126 1313.3439 1313.3346 1313.3870 1313.4402 1313.4112 1313.5079 1313.4342 1313.4623 1313.4538 1313.2768 1313.3426 1313.3805 1313.4648 1313.4677 1313.3637 1313.3261 1313.3676 1313.4474 1313.2868 1313.3647 1313.3973 1313.5097 1313.3700 1313.3824 1313.4652 1313.4556 1313.4542 1313.4409 1313.4827 1313.5086 1313.5059 1313.2905 1313.2927 1313.4567 1313.3677 1313.4440 1313.4698 1313.3804 1313.3671 1313.3419 1313.4626 1313.4341 1313.4647 1313.4471 1313.5065 1313.3621 1313.4748 1313.4124 1313.3432 1313.3560 1313.4725 1313.3464 1313.3048 1313.5092 1313.5072 1313.3936 1313.4379 1313.3618 1313.4003 1313.3947 1313.3563 1313.4570 1313.4337 1313.3707 1313.3692 1313.4122 1313.3466 1313.3417 1313.5229 1313.5090 1313.3696 1313.4981 1313.4526 1313.3710 1313.4559 1313.5085 1313.4615 1313.3449 1313.4338 1313.4475 1313.4708 1313.4343 1313.4407 1313.3584 1313.2223 1313.4553 1313.4644 1313.3987 1313.4593 1313.3355 1313.4310 1313.4679 1313.4539 1313.5069 1313.3711 1313.4558 1313.3566 1313.3088 1313.3440 1313.3983 1313.3972 1313.3215 1313.3974 1313.4635 1313.4105 1313.5074 1313.3528 1313.3409 1313.4622 1313.5249 1313.5017 1313.4701 1313.4808 1313.4333 1313.4562 1313.3689 1313.3852 1313.5023 1313.3596 1313.3479 1313.4529 1313.4571 1313.4724 1313.4329 1313.5091 1313.4643 1313.3703 1313.3809 1313.4602 1313.4313 1313.3803 1313.4719 1313.4522 1313.4544 1313.3806 1313.4523 1313.2852 1313.2247 1313.4225 1313.4678 1313.4941 1313.3248 1313.4710 1313.4336 1313.4537 1313.4368 1313.5087 1313.4397 1313.4437 1313.3513 1313.3420 1313.3481 1313.4472 1313.4618 1313.4360 1313.5050 1313.4631 1313.4733 1313.2790 1313.3295 1313.5228 1313.3813 1313.3558 1313.5095 1313.4709 1313.3669 1313.3661 1313.4530 1313.4682 1313.5075 1313.4681 1313.4668 1313.4113 1313.4478 1313.4661 1313.5101 1313.3643 1313.4400 1313.4323 1313.5022 1313.4641 1313.4600 1313.4477 1313.4378 1313.2172 1313.4863 1313.4479 1313.3445 1313.4309 1313.3670 1313.4639 1313.4541 1313.4371 1313.3564 1313.4347 1313.4655 1313.4418 1313.4704 1313.4148 1313.4114 1313.4352 1313.3489 1313.4345 1313.5100';
177 :     $AdaboostValues{'Streptococcus pneumoniae'}{'co-trimoxazole'}{AUC} = '0.942';
178 :     $AdaboostValues{'Streptococcus pneumoniae'}{'co-trimoxazole'}{F1} = '0.880';
179 :     $AdaboostValues{'Streptococcus pneumoniae'}{'co-trimoxazole'}{ACCURACY} = '0.876';
180 :     $AdaboostValues{'Streptococcus pneumoniae'}{'co-trimoxazole'}{SOURCES} = 'PMID: 24509479; PMID: 25101644';
181 :     $AdaboostValues{'Streptococcus pneumoniae'}{'co-trimoxazole'}{FUNCTION} = 'Co-trimoxazole resistance predicted region';
182 :     #-------------------------------------------------------------
183 :    
184 :    
185 :    
186 :    
187 :    
188 :     #-------------------------------------------------------------
189 :     # Mycobacterium tuberculosis
190 :     #-------------------------------------------------------------
191 :    
192 :     # combined classifier
193 :    
194 :     $AdaboostValues{'Mycobacterium tuberculosis'}{combined}{ANTIBIOTICS} = 'ethambutol ethionamide isoniazid kanamycin ofloxacin rifampicin streptomycin';
195 :     $AdaboostValues{'Mycobacterium tuberculosis'}{combined}{ABBREVIATIONS} = 'EM EA INH K OFX RA S';
196 :     my $MTB_COM = <<"End_of_MTB_COM";
197 :     1.37364 GCACCGGAACCGGTAAGGACGCGATCACCAC
198 :     0.70933 GGCCTTGTACACACCGCCCGTCGCGTCATGA GCCTTGTACACACCGCCCGTCGCGTCATGAA GACTTTCATGACGCGACGGGCGGTGTGTACA CTTGTACACACCGCCCGTCGCGTCATGAAAG CCTTGTACACACCGCCCGTCGCGTCATGAAA GCGACGGGCGGTGTGTACAAGGCCCGGGAAC CGCGACGGGCGGTGTGTACAAGGCCCGGGAA CGACGGGCGGTGTGTACAAGGCCCGGGAACG CCGGGCCTTGTACACACCGCCCGTCGCGTCA CCCGGGCCTTGTACACACCGCCCGTCGCGTC ATGACGCGACGGGCGGTGTGTACAAGGCCCG ACGCGACGGGCGGTGTGTACAAGGCCCGGGA ACTTTCATGACGCGACGGGCGGTGTGTACAA CGCCCGTCGCGTCATGAAAGTCGGTAACACC CCGCCCGTCGCGTCATGAAAGTCGGTAACAC CCGACTTTCATGACGCGACGGGCGGTGTGTA CACACCGCCCGTCGCGTCATGAAAGTCGGTA ACCGCCCGTCGCGTCATGAAAGTCGGTAACA ACACCGCCCGTCGCGTCATGAAAGTCGGTAA ACACACCGCCCGTCGCGTCATGAAAGTCGGT CGACTTTCATGACGCGACGGGCGGTGTGTAC CACCGCCCGTCGCGTCATGAAAGTCGGTAAC GCTTCGGGTGTTACCGACTTTCATGACGCGA CTTCGGGTGTTACCGACTTTCATGACGCGAC CGTCGCGTCATGAAAGTCGGTAACACCCGAA CGCGTCATGAAAGTCGGTAACACCCGAAGCC CCGTCGCGTCATGAAAGTCGGTAACACCCGA GCCCGTCGCGTCATGAAAGTCGGTAACACCC GCGTCATGAAAGTCGGTAACACCCGAAGCCA CCCGTCGCGTCATGAAAGTCGGTAACACCCG CATGACGCGACGGGCGGTGTGTACAAGGCCC
199 :     0.800032 GCGCCGGCGGTGCGGGTGGGGCGGGCACCGA CGGCGGTGCGGGTGGGGCGGGCACCGACGGC CGGCGCCGGCGGTGCGGGTGGGGCGGGCACC CCGGCGGTGCGGGTGGGGCGGGCACCGACGG CGGTGCCCGCCCCACCCGCACCGCCGGCGCC CGCCGGCGGTGCGGGTGGGGCGGGCACCGAC CGTCGGTGCCCGCCCCACCCGCACCGCCGGC
200 :     0.663449 GCGCCAACAGTCGGCGCTTGTGGGTCAACCC GACAGACCGCCGGGCCCCAGCGCCAACAGTC CGGGGTTGACCCACAAGCGCCGACTGTTGGC CGCCGACTGTTGGCGCTGGGGCCCGGCGGTC CGCCAACAGTCGGCGCTTGTGGGTCAACCCC CCCCAGCGCCAACAGTCGGCGCTTGTGGGTC CCCAGCGCCAACAGTCGGCGCTTGTGGGTCA CCAGCGCCAACAGTCGGCGCTTGTGGGTCAA CCACAAGCGCCGACTGTTGGCGCTGGGGCCC CCAACAGTCGGCGCTTGTGGGTCAACCCCGA CAGCGCCAACAGTCGGCGCTTGTGGGTCAAC CAGACCGCCGGGCCCCAGCGCCAACAGTCGG CACAAGCGCCGACTGTTGGCGCTGGGGCCCG CAAGCGCCGACTGTTGGCGCTGGGGCCCGGC AGACCGCCGGGCCCCAGCGCCAACAGTCGGC ACCCACAAGCGCCGACTGTTGGCGCTGGGGC ACAGACCGCCGGGCCCCAGCGCCAACAGTCG ACAAGCGCCGACTGTTGGCGCTGGGGCCCGG AACAGTCGGCGCTTGTGGGTCAACCCCGACA TCACGTGACAGACCGCCGGGCCCCAGCGCCA CGTGACAGACCGCCGGGCCCCAGCGCCAACA CACGTGACAGACCGCCGGGCCCCAGCGCCAA ACTGTTGGCGCTGGGGCCCGGCGGTCTGTCA ACGTGACAGACCGCCGGGCCCCAGCGCCAAC CTGTTGGCGCTGGGGCCCGGCGGTCTGTCAC ACCGCCGGGCCCCAGCGCCAACAGTCGGCGC AAGCGCCGACTGTTGGCGCTGGGGCCCGGCG CCCACAAGCGCCGACTGTTGGCGCTGGGGCC AGCGCCAACAGTCGGCGCTTGTGGGTCAACC AGCGCCGACTGTTGGCGCTGGGGCCCGGCGG CAACAGTCGGCGCTTGTGGGTCAACCCCGAC
201 :     0.629902 GGAGTCTCCGGACATGCCGGGGCGGTTCACA
202 :     0.556449 GGTTACGATCACCAACGACATCACAGTCCAC GGTGGACTGTGATGTCGTTGGTGATCGTAAC GGGTTACGATCACCAACGACATCACAGTCCA GGGTGGACTGTGATGTCGTTGGTGATCGTAA CGGGTGGACTGTGATGTCGTTGGTGATCGTA
203 :     0.643321 CGTAGATCGACACGTCGCCGTGCGGGTGGTA ACTACCACCCGCACGGCGACGTGTCGATCTA CTACCACCCGCACGGCGACGTGTCGATCTAC ACCACCCGCACGGCGACGTGTCGATCTACGA GGCAACTACCACCCGCACGGCGACGTGTCGA GACACGTCGCCGTGCGGGTGGTAGTTGCCCA CGACACGTCGCCGTGCGGGTGGTAGTTGCCC CACGTCGCCGTGCGGGTGGTAGTTGCCCATG CAACTACCACCCGCACGGCGACGTGTCGATC ATCGACACGTCGCCGTGCGGGTGGTAGTTGC ACGTCGCCGTGCGGGTGGTAGTTGCCCATGG ACACGTCGCCGTGCGGGTGGTAGTTGCCCAT AACTACCACCCGCACGGCGACGTGTCGATCT CCACCCGCACGGCGACGTGTCGATCTACGAC
204 :     0.531384 CCGGTCGATGAGCGCGCCCAGCGCGCGAAGA CCCGGTCGATGAGCGCGCCCAGCGCGCGAAG CCCCGGTCGATGAGCGCGCCCAGCGCGCGAA
205 :     0.53187 CCAAAACCCCGAGAGGGGACGGAAACGCATA ATGCGTTTCCGTCCCCTCTCGGGGTTTTGGG ACCCAAAACCCCGAGAGGGGACGGAAACGCA AAACCCCGAGAGGGGACGGAAACGCATATCG AAAACCCCGAGAGGGGACGGAAACGCATATC AACCCCGAGAGGGGACGGAAACGCATATCGC ATATGCGTTTCCGTCCCCTCTCGGGGTTTTG CCGAGAGGGGACGGAAACGCATATCGCCCGC CCCGAGAGGGGACGGAAACGCATATCGCCCG CCCCGAGAGGGGACGGAAACGCATATCGCCC ACCCCGAGAGGGGACGGAAACGCATATCGCC
206 :     0.472756 AATTCGTCGGACGACGGCTACATCCTGGGCG GGCCACGCCCAGGATGTAGCCGTCGTCCGAC GGACGACGGCTACATCCTGGGCGTGGCCCGA CTCGGGCCACGCCCAGGATGTAGCCGTCGTC CGTCGGACGACGGCTACATCCTGGGCGTGGC CGGACGACGGCTACATCCTGGGCGTGGCCCG CCACGCCCAGGATGTAGCCGTCGTCCGACGA CACGCCCAGGATGTAGCCGTCGTCCGACGAA ACGCCCAGGATGTAGCCGTCGTCCGACGAAT ACGACGGCTACATCCTGGGCGTGGCCCGAGT GGGCCACGCCCAGGATGTAGCCGTCGTCCGA GTGGCCCGAGTCGCCGACCACGCCGGCTACA GCGTGGTCGGCGACTCGGGCCACGCCCAGGA GCGTGGCCCGAGTCGCCGACCACGCCGGCTA GCCGGCGTGGTCGGCGACTCGGGCCACGCCC CGTGGCCCGAGTCGCCGACCACGCCGGCTAC CGGCGTGGTCGGCGACTCGGGCCACGCCCAG CCTGGGCGTGGCCCGAGTCGCCGACCACGCC CCGGCGTGGTCGGCGACTCGGGCCACGCCCA AGCCGGCGTGGTCGGCGACTCGGGCCACGCC GGTCGGCGACTCGGGCCACGCCCAGGATGTA GCTACATCCTGGGCGTGGCCCGAGTCGCCGA CTACATCCTGGGCGTGGCCCGAGTCGCCGAC CGGCTACATCCTGGGCGTGGCCCGAGTCGCC CGGCGACTCGGGCCACGCCCAGGATGTAGCC CGACTCGGGCCACGCCCAGGATGTAGCCGTC CGACGGCTACATCCTGGGCGTGGCCCGAGTC CATCCTGGGCGTGGCCCGAGTCGCCGACCAC ATCCTGGGCGTGGCCCGAGTCGCCGACCACG ACGGCTACATCCTGGGCGTGGCCCGAGTCGC ACATCCTGGGCGTGGCCCGAGTCGCCGACCA
207 :     End_of_MTB_COM
208 :     my %load = &Load_Adaboost ($MTB_COM);
209 :     $AdaboostValues{'Mycobacterium tuberculosis'}{combined}{ADABOOST} = \%load;
210 :    
211 :     $AdaboostValues{'Mycobacterium tuberculosis'}{combined}{RESISTANT} = '1295760.3 1438869.3 1397860.3 1397867.3 1448546.3 1295766.3 1324250.3 1397879.3 1438861.3 1397859.3 1438874.3 1455294.3 1455285.3 1397871.3 1455278.3 1295745.3 1400887.3 1324243.3 1295744.3 1455286.3 1295746.3 1295776.3 1295773.3 1397854.3 1397862.3 1397861.3 1400926.3 1455284.3 1397876.3 1400881.3 1295764.3 1448530.3 1397856.3 1295751.3 1455289.3 1295769.3 1295742.3 1455283.3 1397858.3 1455312.3 1448495.3 1397878.3 1267359.3 1295774.3 1295723.3 1455295.3 1295720.3 1295759.3 1324284.3 1397872.3 1295767.3 1417029.3 1324237.3 1455266.3 1295757.3 1438850.3 1448532.3 1295721.3 1400932.3 1448497.3 1295772.3 1295756.3 1397857.3 1295724.3 1400933.3 1397875.3 1455288.3 1397866.3 1400918.3 1295771.3 1455290.3 1400940.3 1400882.3 1400874.3 1397874.3 1295725.3 1448522.3 1438833.3 1295740.3 1448523.3 1397869.3 1438847.3 1397855.3';
212 :     $AdaboostValues{'Mycobacterium tuberculosis'}{combined}{SUSCEPTIBLE} = '1402595.3 1400895.3 1324294.3 1402593.3 1448403.3 1397903.3 1448399.3 1408911.4 1448402.3 1397896.3 1448537.3 1408975.4 1448453.3 1448436.3 1448426.3 1448439.3 1408968.4 1448433.3 1448417.3 1448404.3 1448430.3 1438839.3 1438892.3 1324292.3 1402602.3 1448446.3 1448410.3 1448428.3 1448455.3 1408958.4 1448448.3 1448445.3 1448397.3 1448393.3 1448440.3 1448442.3 1408970.4 1402592.3 1397889.3 1400909.3 1400897.3 1324300.3 1324290.3 1448456.3 1354132.3 1400921.3 1408962.4 83331.31 1408923.4 1448535.3 1448454.3 1408959.4 1448401.3 1402591.3 1408957.4 1448400.3 1397900.3 1408949.4 1324291.3 1448414.3 652616.4 1408960.4 1448434.3 1397890.3 1402598.3 1402599.3 1448459.3 1408956.4 1397893.3 1400904.3 1408953.4 1324299.3 1448407.3 1324298.3 1397892.3 1397894.3 1448431.3 1397899.3 1408938.4 1324301.3 1448405.3 1448452.3 1324288.3';
213 :     $AdaboostValues{'Mycobacterium tuberculosis'}{combined}{AUC} = '0.969';
214 :     $AdaboostValues{'Mycobacterium tuberculosis'}{combined}{F1} = '0.950';
215 :     $AdaboostValues{'Mycobacterium tuberculosis'}{combined}{ACCURACY} = '0.928';
216 :     $AdaboostValues{'Mycobacterium tuberculosis'}{combined}{COMMENTS} = 'This classifier was built to identify multidrug resistant strains. A strain labeled "sensitive" may be resistant to one or more individual antibiotics.';
217 :     $AdaboostValues{'Mycobacterium tuberculosis'}{combined}{SOURCES} = 'TB-ARC initiative, Broad Institute (broadinstitute.org); PMID: 25599400';
218 :     $AdaboostValues{'Mycobacterium tuberculosis'}{combined}{FUNCTION} = 'Antibiotic resistance predicted region';
219 :    
220 :    
221 :    
222 :     # isoniazid
223 :    
224 :     $AdaboostValues{'Mycobacterium tuberculosis'}{isoniazid}{ANTIBIOTICS} = 'isoniazid';
225 :     $AdaboostValues{'Mycobacterium tuberculosis'}{isoniazid}{ABBREVIATIONS} = 'INH';
226 :     my $MTB_INH = <<"End_of_MTB_INH";
227 :     0.982236 GCACCGGAACCGGTAAGGACGCGATCACCAC
228 :     0.517329 CAACGGCATCGGCGGCAACGGCGGCAACGGC AACGGCATCGGCGGCAACGGCGGCAACGGCG ACAACGGCATCGGCGGCAACGGCGGCAACGG
229 :     0.243596 CCGAGGAGATCGAGGGCTACCGGCTGACCGG CGGTCAGCCGGTAGCCCTCGATCTCCTCGGC
230 :     0.162134 CACGTATCTGGTTTCGGGTGGGTCGTTGTGA AAACCAGATACGTGCCCAGGACACCGAACTC CCCACCCGAAACCAGATACGTGCCCAGGACA CCAGATACGTGCCCAGGACACCGAACTCGAC AACGACCCACCCGAAACCAGATACGTGCCCA ACCAGATACGTGCCCAGGACACCGAACTCGA ACGGTCGAGTTCGGTGTCCTGGGCACGTATC AGATACGTGCCCAGGACACCGAACTCGACCG CAGATACGTGCCCAGGACACCGAACTCGACC CCCGAAACCAGATACGTGCCCAGGACACCGA ACCCACCCGAAACCAGATACGTGCCCAGGAC ACCCGAAACCAGATACGTGCCCAGGACACCG ACGACCCACCCGAAACCAGATACGTGCCCAG CAACGACCCACCCGAAACCAGATACGTGCCC CCGAAACCAGATACGTGCCCAGGACACCGAA CCTGGGCACGTATCTGGTTTCGGGTGGGTCG GACCCACCCGAAACCAGATACGTGCCCAGGA CCACCCGAAACCAGATACGTGCCCAGGACAC CACCCGAAACCAGATACGTGCCCAGGACACC AGTTCGGTGTCCTGGGCACGTATCTGGTTTC CGAAACCAGATACGTGCCCAGGACACCGAAC AACCAGATACGTGCCCAGGACACCGAACTCG ACAACGACCCACCCGAAACCAGATACGTGCC CACAACGACCCACCCGAAACCAGATACGTGC
231 :     0.155026 AACAGTCGGCGCTTGTGGGTCAACCCCGACA
232 :     0.194342 CCCGGTGTCGTGGATCATGTGGGTTTGGTAC
233 :     0.137526 AAGCGCCGACTGTTGGCGCTGGGGCCCGGCG CAACAGTCGGCGCTTGTGGGTCAACCCCGAC CTGTTGGCGCTGGGGCCCGGCGGTCTGTCAC ACGTGACAGACCGCCGGGCCCCAGCGCCAAC AGCGCCAACAGTCGGCGCTTGTGGGTCAACC AGCGCCGACTGTTGGCGCTGGGGCCCGGCGG ACCGCCGGGCCCCAGCGCCAACAGTCGGCGC CCCACAAGCGCCGACTGTTGGCGCTGGGGCC CGGGGTTGACCCACAAGCGCCGACTGTTGGC ACTGTTGGCGCTGGGGCCCGGCGGTCTGTCA CACGTGACAGACCGCCGGGCCCCAGCGCCAA CGTGACAGACCGCCGGGCCCCAGCGCCAACA TCACGTGACAGACCGCCGGGCCCCAGCGCCA ACAAGCGCCGACTGTTGGCGCTGGGGCCCGG ACAGACCGCCGGGCCCCAGCGCCAACAGTCG ACCCACAAGCGCCGACTGTTGGCGCTGGGGC AGACCGCCGGGCCCCAGCGCCAACAGTCGGC CAAGCGCCGACTGTTGGCGCTGGGGCCCGGC CACAAGCGCCGACTGTTGGCGCTGGGGCCCG CAGACCGCCGGGCCCCAGCGCCAACAGTCGG CAGCGCCAACAGTCGGCGCTTGTGGGTCAAC CCAACAGTCGGCGCTTGTGGGTCAACCCCGA CCACAAGCGCCGACTGTTGGCGCTGGGGCCC CCAGCGCCAACAGTCGGCGCTTGTGGGTCAA CCCAGCGCCAACAGTCGGCGCTTGTGGGTCA CGCCAACAGTCGGCGCTTGTGGGTCAACCCC CGCCGACTGTTGGCGCTGGGGCCCGGCGGTC GACAGACCGCCGGGCCCCAGCGCCAACAGTC GCGCCAACAGTCGGCGCTTGTGGGTCAACCC CCCCAGCGCCAACAGTCGGCGCTTGTGGGTC
234 :     0.126215 GGGGTCGGCGGCGACGCCGGCGATGGCGGCA CCGGTGCCGCCATCGCCGGCGTCGCCGCCGA GGTCGGCGGCGACGCCGGCGATGGCGGCACC CGGTGCCGCCATCGCCGGCGTCGCCGCCGAC GGGTCGGCGGCGACGCCGGCGATGGCGGCAC GCCGCCATCGCCGGCGTCGCCGCCGACCCCA
235 :     0.10899 TGTTTGCCTTCCTCGCCCTTGACCGAAAACA CAAGGGCGAGGAAGGCAAACAGGCCCTGGAC AGGGCCTGTTTGCCTTCCTCGCCCTTGACCG GCCTGTTTGCCTTCCTCGCCCTTGACCGAAA CAGGAGATCCACCGGTCCAGGGCCTGTTTGC AGGAAGGCAAACAGGCCCTGGACCGGTGGAT GGCCTGTTTGCCTTCCTCGCCCTTGACCGAA CATGTGTTTTCGGTCAAGGGCGAGGAAGGCA GAGGAAGGCAAACAGGCCCTGGACCGGTGGA AGGGCGAGGAAGGCAAACAGGCCCTGGACCG TCAAGGGCGAGGAAGGCAAACAGGCCCTGGA TGTGTTTTCGGTCAAGGGCGAGGAAGGCAAA CTGTTTGCCTTCCTCGCCCTTGACCGAAAAC GTGTTTTCGGTCAAGGGCGAGGAAGGCAAAC ATGTGTTTTCGGTCAAGGGCGAGGAAGGCAA GCATGTGTTTTCGGTCAAGGGCGAGGAAGGC AAGGCAAACAGGCCCTGGACCGGTGGATCTC AAGGGCGAGGAAGGCAAACAGGCCCTGGACC ACCGGTCCAGGGCCTGTTTGCCTTCCTCGCC AGGCAAACAGGCCCTGGACCGGTGGATCTCC CAAACAGGCCCTGGACCGGTGGATCTCCTGG CACCGGTCCAGGGCCTGTTTGCCTTCCTCGC CCACCGGTCCAGGGCCTGTTTGCCTTCCTCG CCAGGGCCTGTTTGCCTTCCTCGCCCTTGAC CCGGTCCAGGGCCTGTTTGCCTTCCTCGCCC GATCCACCGGTCCAGGGCCTGTTTGCCTTCC GGGCCTGTTTGCCTTCCTCGCCCTTGACCGA AGATCCACCGGTCCAGGGCCTGTTTGCCTTC CCTGTTTGCCTTCCTCGCCCTTGACCGAAAA AGGAGATCCACCGGTCCAGGGCCTGTTTGCC CAGGGCCTGTTTGCCTTCCTCGCCCTTGACC
236 :     0.124565 CAATACGATCAGAGTGGTATTTCAACAACGA CCAATACGATCAGAGTGGTATTTCAACAACG AGTCGTTGTTGAAATACCACTCTGATCGTAT GAGTCGTTGTTGAAATACCACTCTGATCGTA ACGATCAGAGTGGTATTTCAACAACGACTCC AATACGATCAGAGTGGTATTTCAACAACGAC
237 :     End_of_MTB_INH
238 :     my %load = &Load_Adaboost ($MTB_INH);
239 :     $AdaboostValues{'Mycobacterium tuberculosis'}{isoniazid}{ADABOOST} = \%load;
240 :    
241 :     $AdaboostValues{'Mycobacterium tuberculosis'}{isoniazid}{RESISTANT} = '1397906.3 1354130.3 1448606.3 1408941.4 1422084.3 1408933.4 1408931.4 1438834.3 1448395.3 1421993.3 1455263.3 1448498.3 1448690.3 1421937.3 1448694.3 1455311.3 1448517.3 1438884.3 1354108.3 1448797.3 1422098.3 1422036.3 1448786.3 1421992.3 1448762.3 1422055.3 1448731.3 1354129.3 1421962.3 1421921.3 1448673.3 1422021.3 1448598.3 1324265.3 1422040.3 1438835.3 1324230.3 1448555.3 1773.298 1438867.3 1422104.3 1421996.3 1324268.3 1324249.3 1422068.3 1397865.3 1408944.4 1400931.3 1324254.3 1448512.3 1324244.3 1324247.3 1397921.3 1447466.3 1400873.3 1422076.3 1408906.4 1448622.3 1448680.3 1421928.3 1324266.3 1422005.3 1324263.3 1397909.3 1422092.3 1447473.3 1324267.3 1448641.3 1422038.3 1773.361 1448834.3 1422022.3 1438840.3 1408972.3 1408937.4 1455274.3 1324275.3 1448508.3 1422093.3 1408965.4 1295791.3 1422008.3 1408919.4 1267361.3 1422012.3 1422069.3 1324231.3 1324257.3 1438843.3 1421977.3 1422065.3 1408913.4 1397908.3 1448604.3 1448516.3 1400916.3 1324245.3 1448568.3 1421941.3 1354112.3 1773.345 1448550.3 1422087.3 1438837.3 1421986.3 1422049.3 1448605.3 1324252.3 1408971.4 1324259.3 1422045.3 1448482.3 1324255.3 1295804.3 1448567.3 1324239.3 1448435.3 1267363.3 1773.310 1448783.3 1422014.3 1421988.3 1422079.3 1448491.3 1397881.3 1408921.4 1324261.3 1421957.3 1448627.3 1408945.4 1773.366 1354120.3 1408926.4 1448514.3 1422026.3 1448527.3 1324227.3 1422085.3 1324271.3 1421954.3 1422082.3 1421966.3 1448807.3 1448492.3 1422009.3 1421956.3 1448501.3 1448735.3 1438836.3 1422064.3 1421975.3 1421971.3 1438856.3 1448490.3 1438878.3 1448538.3 1448618.3 1408967.4 1295796.3 1324240.3 1448608.3 1422054.3 1448798.3 1408925.4 1324256.3 1422013.3 1422016.3 1448687.3 1448529.3 1422073.3 1324287.3 1408936.4 1421932.3 1438841.3 1324270.3 1354131.3 1455291.3 1295763.3 1448545.3 1397913.3 1422024.3 1421973.3 1448563.3 1408927.4 1448693.3 1448602.3 1400912.3 1773.372 1408952.4 1422061.3 1421968.3 1448526.3 1408932.4 1324238.3 1324242.3 1448704.3 1408916.4 1438842.3 1448551.3 1447470.3 1422042.3 1408939.4 1448552.3 1448485.3 1324253.3 1400898.3 1422018.3 1448689.3 1408942.4 1448593.3 1455302.3 1408973.4 1267358.3 1448547.3 1324241.3 1408964.4 1408963.4 1324223.3 1448670.3 1448756.3 1295790.3 1324228.3 1422059.3 1324273.3 1295782.3 1448646.3 1324276.3 1773.347 1408934.4 1267360.3 1267357.3 1324274.3 1438866.3 1397907.3 1324280.3 1422001.3 1408905.4 1408935.4 1448519.3 1324226.3 1421990.3 1421982.3 1773.301 1324233.3 1448509.3 1448594.3 1408907.4 1448561.3';
242 :     $AdaboostValues{'Mycobacterium tuberculosis'}{isoniazid}{SUSCEPTIBLE} = '1448766.3 1448706.3 1448826.3 1354145.3 1448803.3 1448660.3 1773.265 1448643.3 1354157.3 1448635.3 1448698.3 1448677.3 1448763.3 1448730.3 1447450.3 1773.294 1324218.3 1773.268 1448642.3 1448733.3 1448751.3 1354140.3 1448710.3 1448738.3 1448616.3 1397911.3 1448619.3 1448720.3 1448663.3 1773.322 1448655.3 1448831.3 1448696.3 1354150.3 1448647.3 1448711.3 1448758.3 1447482.3 1447500.3 1354154.3 1773.290 1448633.3 1448823.3 1448808.3 1448707.3 1448676.3 1448739.3 1354153.3 1448615.3 1773.364 1448799.3 1448636.3 1408955.4 1324222.3 1354156.3 1773.273 1773.358 1448623.3 1447477.3 1448811.3 1773.317 1448723.3 1773.285 1448800.3 1448620.3 1448815.3 1448664.3 1448717.3 1448667.3 1448639.3 1448654.3 1773.360 1448697.3 1448634.3 1448681.3 1448830.3 1448759.3 1447435.3 1448727.3 1448787.3 1773.363 1354152.3 1295726.3 1447456.3 1448632.3 1448672.3 1448684.3 1448675.3 1448688.3 1448656.3 1773.356 1448770.3 1773.349 1773.355 1773.295 1448613.3 1448626.3 1448648.3 1448726.3 1448719.3 1448771.3 1324262.3 1448790.3 1447447.3 1773.292 1448796.3 1448718.3 1447509.3 1448691.3 1773.338 1773.369 1773.332 1448752.3 1448754.3 1448612.3 1448692.3 1448792.3 1448671.3 1773.309 1448653.3 1408947.4 1400928.3 1448765.3 1773.341 1448705.3 1354159.3 1773.334 1448740.3 1448768.3 1448630.3 1773.323 1448703.3 1448649.3 1447464.3 1448629.3 1447436.3 1448795.3 1447485.3 1448644.3 1448755.3 1448713.3 1448645.3 1448721.3 1448794.3 1448734.3 1448714.3 1354141.3 1295727.3 1448773.3 1448791.3 1448621.3 1448760.3 1448624.3 1448625.3 1447508.3 1448657.3 1773.368 1448779.3 1448737.3 1773.280 1448757.3 1448700.3 1773.315 1354158.3 1448666.3 1448746.3 1448775.3 1448685.3 1448686.3 1448631.3 1773.274 1447521.3 1448712.3 1773.324 1448806.3 1773.357 1773.276 1448732.3 1448682.3 1448674.3 1773.289 1448611.3 1448651.3 1447522.3 1448679.3 1448708.3 1448724.3 1448747.3 1354148.3 1448802.3 1773.279 1448816.3 1448772.3 1448761.3 1448699.3 1354133.3 1447467.3 1267364.3 1448683.3 1448610.3 1448709.3 1448778.3 1448829.3 1354137.3 1354155.3 1448828.3 1448669.3 1448836.3 1448725.3 1448774.3 1773.293 1448819.3 1448665.3 1448722.3 1447459.3 1448837.3 1354146.3 1773.346 1448817.3 1773.328 1397912.3 1448814.3 1447516.3 1448822.3 1354139.3 1447452.3 1354147.3 1448701.3 1773.316 1448638.3 1448776.3 1448769.3 1448745.3 1448728.3 1448668.3 1448659.3 1448678.3 1447513.3 1773.320 1448789.3 1448562.3 1448767.3 1447517.3 1354143.3 1448825.3 1448614.3 1324235.3 1448729.3';
243 :     $AdaboostValues{'Mycobacterium tuberculosis'}{isoniazid}{AUC} = '0.911';
244 :     $AdaboostValues{'Mycobacterium tuberculosis'}{isoniazid}{F1} = '0.872';
245 :     $AdaboostValues{'Mycobacterium tuberculosis'}{isoniazid}{ACCURACY} = '0.882';
246 :     $AdaboostValues{'Mycobacterium tuberculosis'}{isoniazid}{SOURCES} = 'TB-ARC initiative, Broad Institute (broadinstitute.org); PMID: 25599400';
247 :     $AdaboostValues{'Mycobacterium tuberculosis'}{isoniazid}{FUNCTION} = 'Isoniazid resistance predicted region';
248 :    
249 :    
250 :     # kanamycin
251 :    
252 :     $AdaboostValues{'Mycobacterium tuberculosis'}{kanamycin}{ANTIBIOTICS} = 'kanamycin';
253 :     $AdaboostValues{'Mycobacterium tuberculosis'}{kanamycin}{ABBREVIATIONS} = 'K';
254 :     my $MTB_K = <<"End_of_MTB_K";
255 :     0.994698 CTTCGGGTGTTACCGACTTTCATGACGCGAC CGTCGCGTCATGAAAGTCGGTAACACCCGAA CGCGTCATGAAAGTCGGTAACACCCGAAGCC CCGTCGCGTCATGAAAGTCGGTAACACCCGA GCCCGTCGCGTCATGAAAGTCGGTAACACCC GCTTCGGGTGTTACCGACTTTCATGACGCGA GCGACGGGCGGTGTGTACAAGGCCCGGGAAC CGCGACGGGCGGTGTGTACAAGGCCCGGGAA CGACGGGCGGTGTGTACAAGGCCCGGGAACG CCGGGCCTTGTACACACCGCCCGTCGCGTCA CCCGGGCCTTGTACACACCGCCCGTCGCGTC ATGACGCGACGGGCGGTGTGTACAAGGCCCG ACGCGACGGGCGGTGTGTACAAGGCCCGGGA CCCGTCGCGTCATGAAAGTCGGTAACACCCG CGCCCGTCGCGTCATGAAAGTCGGTAACACC CCGCCCGTCGCGTCATGAAAGTCGGTAACAC CCGACTTTCATGACGCGACGGGCGGTGTGTA CACCGCCCGTCGCGTCATGAAAGTCGGTAAC CACACCGCCCGTCGCGTCATGAAAGTCGGTA ACCGCCCGTCGCGTCATGAAAGTCGGTAACA ACACCGCCCGTCGCGTCATGAAAGTCGGTAA ACACACCGCCCGTCGCGTCATGAAAGTCGGT GCGTCATGAAAGTCGGTAACACCCGAAGCCA CATGACGCGACGGGCGGTGTGTACAAGGCCC GGCCTTGTACACACCGCCCGTCGCGTCATGA GCCTTGTACACACCGCCCGTCGCGTCATGAA GACTTTCATGACGCGACGGGCGGTGTGTACA CTTGTACACACCGCCCGTCGCGTCATGAAAG CGACTTTCATGACGCGACGGGCGGTGTGTAC CCTTGTACACACCGCCCGTCGCGTCATGAAA ACTTTCATGACGCGACGGGCGGTGTGTACAA
256 :     0.493608 GAGGAGCCGGGCAGTCAGCCCCGCCCGGCGA GAGCCGGGCAGTCAGCCCCGCCCGGCGACGA CGTCGCCGGGCGGGGCTGACTGCCCGGCTCC CGCCGGGCGGGGCTGACTGCCCGGCTCCTCA CATCGTCGCCGGGCGGGGCTGACTGCCCGGC AGGAGCCGGGCAGTCAGCCCCGCCCGGCGAC AGCCGGGCAGTCAGCCCCGCCCGGCGACGAT GGCGGCCCGCATCGTCGCCGGGCGGGGCTGA GCGGCCCGCATCGTCGCCGGGCGGGGCTGAC GCCCGGCGACGATGCGGGCCGCCCAGCGGCC GCAGTCAGCCCCGCCCGGCGACGATGCGGGC CTGGGCGGCCCGCATCGTCGCCGGGCGGGGC CGGCGACGATGCGGGCCGCCCAGCGGCCCGC CGCCCGGCGACGATGCGGGCCGCCCAGCGGC CGCATCGTCGCCGGGCGGGGCTGACTGCCCG CCGGGCAGTCAGCCCCGCCCGGCGACGATGC CCGGCGACGATGCGGGCCGCCCAGCGGCCCG CCGCCCGGCGACGATGCGGGCCGCCCAGCGG CCGCATCGTCGCCGGGCGGGGCTGACTGCCC CCCGCCCGGCGACGATGCGGGCCGCCCAGCG CCCGCATCGTCGCCGGGCGGGGCTGACTGCC CCCCGCCCGGCGACGATGCGGGCCGCCCAGC CAGTCAGCCCCGCCCGGCGACGATGCGGGCC CAGCCCCGCCCGGCGACGATGCGGGCCGCCC AGTCAGCCCCGCCCGGCGACGATGCGGGCCG AGCCCCGCCCGGCGACGATGCGGGCCGCCCA CCCGGCGACGATGCGGGCCGCCCAGCGGCCC
257 :     0.263661 ACCACCCGCACGGCGACGTGTCGATCTACGA CCACCCGCACGGCGACGTGTCGATCTACGAC
258 :     0.272479 GCGGGGTCTGGTCATCGGGGTTGCACGCCCC GAGCGGGGTCTGGTCATCGGGGTTGCACGCC CGAGCGGGGTCTGGTCATCGGGGTTGCACGC CCACGAGCGGGGTCTGGTCATCGGGGTTGCA AGCGGGGTCTGGTCATCGGGGTTGCACGCCC ACGAGCGGGGTCTGGTCATCGGGGTTGCACG CACGAGCGGGGTCTGGTCATCGGGGTTGCAC
259 :     0.175762 TTTCTTCGACTGGTGCCCCCCCCCCAAAAAA TTCTTCGACTGGTGCCCCCCCCCCAAAAAAA GTTTCTTCGACTGGTGCCCCCCCCCCAAAAA GGTTTCTTCGACTGGTGCCCCCCCCCCAAAA CGGGTTTCTTCGACTGGTGCCCCCCCCCCAA GGGTTTCTTCGACTGGTGCCCCCCCCCCAAA TCGGGTTTCTTCGACTGGTGCCCCCCCCCCA
260 :     0.208843 ACCGATCGATGACCCGATGCGCGCCACATCC
261 :     0.167045 CATGAACCGCCCCGGCATGTCCGGAGACTCC
262 :     0.142523 AGAGTCTCCGGACTCACCGGGGCGGTTCAGG
263 :     0.173157 GGGGCTAGCGGTTCACCGGTGAGTGCTCGAC GGCTAGCGGTTCACCGGTGAGTGCTCGACGA CTCGTCGAGCACTCACCGGTGAACCGCTAGC CGTCGAGCACTCACCGGTGAACCGCTAGCCC CCTCGTCGAGCACTCACCGGTGAACCGCTAG AGCGGTTCACCGGTGAGTGCTCGACGAGGTC ACCTCGTCGAGCACTCACCGGTGAACCGCTA GCGGTTCACCGGTGAGTGCTCGACGAGGTCC
264 :     0.16423 GGCCAGAACAACCCGCTGTCGGGGTTGACCC GCCAGAACAACCCGCTGTCGGGGTTGACCCA
265 :     End_of_MTB_K
266 :     my %load = &Load_Adaboost ($MTB_K);
267 :     $AdaboostValues{'Mycobacterium tuberculosis'}{kanamycin}{ADABOOST} = \%load;
268 :     $AdaboostValues{'Mycobacterium tuberculosis'}{kanamycin}{RESISTANT} = '1400935.3 1397874.3 1400916.3 1438849.3 1400940.3 1400920.3 1417009.3 1448530.3 1397857.3 1448588.3 1400871.3 1408964.4 1295771.3 1417029.3 1438852.3 1448524.3 1397883.3 1295740.3 1455287.3 1295759.3 1417017.3 1397878.3 1448522.3 1448495.3 1448576.3 1400883.3 1324278.3 1438844.3 1455285.3 1448574.3 1324231.3 1324221.3 1397855.3 1438873.3 1448585.3 1324250.3 1397859.3 1438874.3 1422044.3 1448592.3 1455286.3 1295742.3 1448591.3 1295744.3 1455284.3 1438850.3 1448582.3 1400922.3 1448577.3 1324262.3 1400937.3 1455283.3 1267359.3 1324284.3 1438847.3 1417011.3 1400933.3 1400874.3 1448569.3 1408947.4 1455278.3 1448579.3 1417028.3 1295774.3 1295747.3 1400887.3 1455308.3 1448595.3 1397866.3 1400918.3 1455294.3 1455307.3 1448580.3 1295776.3 1400882.3 1448597.3 1438877.3 1448561.3 1295767.3 1455266.3 1397862.3 1438869.3 1397872.3 1295721.3 1400923.3 1397871.3 1400891.3 1408955.4 1417019.3 1455305.3 1295766.3 1417026.3 1455290.3 1417031.3 1267356.3 1397867.3 1295772.3 1455276.3 1448572.3 1295756.3 1397875.3 1448586.3 1295723.3 1400873.3 1455312.3 1438851.3 1295751.3 1422095.3 1400875.3 1448584.3 1397885.3 1438863.3 1448575.3 1400889.3 1397884.3 1417013.3 1448589.3 1448571.3 1448587.3 1324272.3 1295746.3 1455292.3 1397888.3 1438859.3 1400914.3 1438864.3 1400881.3 1400941.3 1400926.3 1400877.3 1295773.3 1408952.4 1448570.3 1324260.3 1295725.3 1397854.3 1295745.3 1455288.3 1438833.3 1397921.3 1397865.3 1397858.3 1408969.4 1397920.3 1397861.3 1438861.3 1400924.3 1397876.3 1455295.3 1295724.3 1455289.3 1422100.3 1400870.3 1324273.3 1417023.3 1324229.3 1397922.3 1448497.3 1324237.3 1400932.3 1295764.3 1324243.3 1448609.3 1295757.3 1397856.3 1400928.3 1295760.3 1448523.3 1397882.3 1448573.3 1400880.3 1417027.3 1408954.4 1397879.3 1448546.3 1417018.3 1295720.3 1295769.3 1324236.3 1397873.3 1400888.3 1400872.3 1397853.3 1397869.3 1448532.3 1417008.3 1397860.3';
269 :     $AdaboostValues{'Mycobacterium tuberculosis'}{kanamycin}{SUSCEPTIBLE} = '1417014.3 1295790.3 1324282.3 1421941.3 1324245.3 1448463.3 1448552.3 1438870.3 1400938.3 1397880.3 1397915.3 1397935.3 1421993.3 1455263.3 1408921.4 1448491.3 1448474.3 1438872.3 1448477.3 1397863.3 1448593.3 1448559.3 1295791.3 1448516.3 1438868.3 1397926.3 1448472.3 1448506.3 1448604.3 1397933.3 1448483.3 1422059.3 1422038.3 1422016.3 1397936.3 1422052.3 1455269.3 1422014.3 1295758.3 1421983.3 1448395.3 1438838.3 1448538.3 1397923.3 1448526.3 1448554.3 1455293.3 1295782.3 1295796.3 1408926.4 1422042.3 1438853.3 1438862.3 1448505.3 1438854.3 1354120.3 1324253.3 1448484.3 1422005.3 1448598.3 1438845.3 1448551.3 1324271.3 1438842.3 1397924.3 1295775.3 1448517.3 1448466.3 1397913.3 1455268.3 1438865.3 1397881.3 1295795.3 1408907.4 1397886.3 1438834.3 1400925.3 1267357.3 1448519.3 1400915.3 1448480.3 1448469.3 1408945.4 1324287.3 1324267.3 1455291.3 1324281.3 1397931.3 1422073.3 1324222.3 1455270.3 1448605.3 1397864.3 1448471.3 1408965.4 1422082.3 1295727.3 1324228.3 1417030.3 1448467.3 1422076.3 1422022.3 1324255.3 1422009.3 1448473.3 1421992.3 1267360.3 1408972.3 1448594.3 1295726.3 1448607.3 1408932.4 1400939.3 1324280.3 1408913.4 1267364.3 1422064.3 1448462.3 1422040.3 1324248.3 1400930.3 1448602.3 1408950.4 1422026.3 1408963.4 1448567.3 1438856.3 1448564.3 1448476.3 1408904.4 1324251.3 1400884.3 1324283.3 1397917.3 1421997.3 1422055.3 1438841.3 1295739.3 1295781.3 1397919.3 1397914.3 1295763.3 1422018.3 1455311.3 1448508.3 1324230.3 1448512.3 1417010.3 1438884.3 1400886.3 1397910.3 1324274.3 1448492.3 1421969.3 1448555.3 1324232.3 1438858.3 1422061.3 1417015.3 1397932.3 1448488.3 1448560.3 1324279.3 1448478.3 1448563.3 1448599.3 1422087.3 1448606.3 1324249.3 1422054.3 1397934.3 1422092.3 1438848.3 1422069.3 1438836.3 1448544.3 1448481.3 1422098.3 1422029.3 1324239.3 1422047.3 1448475.3 1421990.3 1397908.3 1400885.3 1438866.3 1324218.3';
270 :     $AdaboostValues{'Mycobacterium tuberculosis'}{kanamycin}{AUC} = '0.898';
271 :     $AdaboostValues{'Mycobacterium tuberculosis'}{kanamycin}{F1} = '0.871';
272 :     $AdaboostValues{'Mycobacterium tuberculosis'}{kanamycin}{ACCURACY} = '0.872';
273 :     $AdaboostValues{'Mycobacterium tuberculosis'}{kanamycin}{SOURCES} = 'TB-ARC initiative, Broad Institute (broadinstitute.org); PMID: 25599400';
274 :     $AdaboostValues{'Mycobacterium tuberculosis'}{kanamycin}{FUNCTION} = 'Kanamycin resistance predicted region';
275 :    
276 :    
277 :     # ofloxacin
278 :    
279 :     $AdaboostValues{'Mycobacterium tuberculosis'}{ofloxacin}{ANTIBIOTICS} = 'ofloxacin';
280 :     $AdaboostValues{'Mycobacterium tuberculosis'}{ofloxacin}{ABBREVIATIONS} = 'OFX';
281 :     my $MTB_OFX = <<"End_of_MTB_OFX";
282 :     0.471401 ACGTCGCCGTGCGGGTGGTAGTTGCCCATGG CACGTCGCCGTGCGGGTGGTAGTTGCCCATG
283 :     0.373188 CGTGTTCTGCCCCAACAGATTCGACACCGCC GTGTTCTGCCCCAACAGATTCGACACCGCCA GCCGCGATCGCCGGCGTGTTCTGCCCCAACA AATCTGTTGGGGCAGAACACGCCGGCGATCG ATCGCCGGCGTGTTCTGCCCCAACAGATTCG ATCTGTTGGGGCAGAACACGCCGGCGATCGC CCGCGATCGCCGGCGTGTTCTGCCCCAACAG CCGGCGTGTTCTGCCCCAACAGATTCGACAC CGCCGGCGTGTTCTGCCCCAACAGATTCGAC CGCGATCGCCGGCGTGTTCTGCCCCAACAGA CGGCCGCGATCGCCGGCGTGTTCTGCCCCAA CGGCGTGTTCTGCCCCAACAGATTCGACACC CGGTGTCGAATCTGTTGGGGCAGAACACGCC GAATCTGTTGGGGCAGAACACGCCGGCGATC GCCGGCGTGTTCTGCCCCAACAGATTCGACA GCGGTGTCGAATCTGTTGGGGCAGAACACGC GGCCGCGATCGCCGGCGTGTTCTGCCCCAAC TCGAATCTGTTGGGGCAGAACACGCCGGCGA
284 :     0.236434 ATCGACACGTCGCCGTGCGGGTGGTAGTTGC CGACACGTCGCCGTGCGGGTGGTAGTTGCCC ACACGTCGCCGTGCGGGTGGTAGTTGCCCAT CAACTACCACCCGCACGGCGACGTGTCGATC GGCAACTACCACCCGCACGGCGACGTGTCGA ACTACCACCCGCACGGCGACGTGTCGATCTA CGTAGATCGACACGTCGCCGTGCGGGTGGTA AACTACCACCCGCACGGCGACGTGTCGATCT GACACGTCGCCGTGCGGGTGGTAGTTGCCCA CTACCACCCGCACGGCGACGTGTCGATCTAC
285 :     0.208438 AAGACCGTCGGTGTGGCGTTGACGGTGACGC ACCGTCAACGCCACACCGACGGTCTTCGTGG ACGCCACACCGACGGTCTTCGTGGAATTCAG CGCCACACCGACGGTCTTCGTGGAATTCAGC AATTCCACGAAGACCGTCGGTGTGGCGTTGA ACCGTCGGTGTGGCGTTGACGGTGACGCCGC CAACGCCACACCGACGGTCTTCGTGGAATTC CACCGTCAACGCCACACCGACGGTCTTCGTG CCGTCAACGCCACACCGACGGTCTTCGTGGA CCGTCGGTGTGGCGTTGACGGTGACGCCGCC CGGCGTCACCGTCAACGCCACACCGACGGTC CGTCAACGCCACACCGACGGTCTTCGTGGAA CGTCACCGTCAACGCCACACCGACGGTCTTC ATTCCACGAAGACCGTCGGTGTGGCGTTGAC CGAAGACCGTCGGTGTGGCGTTGACGGTGAC AACGCCACACCGACGGTCTTCGTGGAATTCA AGACCGTCGGTGTGGCGTTGACGGTGACGCC ACGAAGACCGTCGGTGTGGCGTTGACGGTGA
286 :     0.22097 GACCAGGGCTGGGCCATGCGCACCAGGGTGC
287 :     0.210711 ACGTAGTTGGCCGGTGCTTCTTCTCCACCTA AGGTGGAGAAGAAGCACCGGCCAACTACGTG GCACGTAGTTGGCCGGTGCTTCTTCTCCACC TGGAGAAGAAGCACCGGCCAACTACGTGCCA TGACGGTAGGTGGAGAAGAAGCACCGGCCAA CCGGTGCTTCTTCTCCACCTACCGTCAATCC CTGGCACGTAGTTGGCCGGTGCTTCTTCTCC GGTGCTTCTTCTCCACCTACCGTCAATCCGA CGGTAGGTGGAGAAGAAGCACCGGCCAACTA GATTGACGGTAGGTGGAGAAGAAGCACCGGC GGTAGGTGGAGAAGAAGCACCGGCCAACTAC GAGAAGAAGCACCGGCCAACTACGTGCCAGC TGGCCGGTGCTTCTTCTCCACCTACCGTCAA CTCGGATTGACGGTAGGTGGAGAAGAAGCAC TCTCGGATTGACGGTAGGTGGAGAAGAAGCA GACGGTAGGTGGAGAAGAAGCACCGGCCAAC CGTAGTTGGCCGGTGCTTCTTCTCCACCTAC CGGATTGACGGTAGGTGGAGAAGAAGCACCG ATTGACGGTAGGTGGAGAAGAAGCACCGGCC GGCACGTAGTTGGCCGGTGCTTCTTCTCCAC ACGGTAGGTGGAGAAGAAGCACCGGCCAACT
288 :     0.217565 CACCCGCACGGCGACGCGTCGATCTACGCCA ACCACCCGCACGGCGACGCGTCGATCTACGC CCACCCGCACGGCGACGCGTCGATCTACGCC
289 :     0.217662 ACCTTCCGAAGCGCCGAGTTCGGCTTCTTCG CCGAAGAAGCCGAACTCGGCGCTTCGGAAGG
290 :     0.152744 ACGGCGGGCTGTTCGGCGCCGGCGGGGCGGG CGCCCGCCCCGCCGGCGCCGAACAGCCCGCC CGGCGGGCTGTTCGGCGCCGGCGGGGCGGGC AACGGCGGGCTGTTCGGCGCCGGCGGGGCGG
291 :     0.163602 AGAAGCACCGGCCAACTACGTGCCAGCAGCC AGCACCGGCCAACTACGTGCCAGCAGCCGCG CCGCGGCTGCTGGCACGTAGTTGGCCGGTGC AAGCACCGGCCAACTACGTGCCAGCAGCCGC CGGCTGCTGGCACGTAGTTGGCCGGTGCTTC ACCGCGGCTGCTGGCACGTAGTTGGCCGGTG
292 :     End_of_MTB_OFX
293 :     my %load = &Load_Adaboost ($MTB_OFX);
294 :     $AdaboostValues{'Mycobacterium tuberculosis'}{ofloxacin}{ADABOOST} = \%load;
295 :     $AdaboostValues{'Mycobacterium tuberculosis'}{ofloxacin}{RESISTANT} = '1295806.3 1402586.3 1400918.3 1400874.3 1400888.3 1448573.3 1397924.3 1422029.3 1400933.3 1400935.3 1295747.3 1400932.3 1448483.3 1295740.3 1408950.4 1295742.3 1400887.3 1455312.3 1408951.4 1448522.3 1324221.3 1397869.3 1417016.3 1295766.3 1448532.3 1295804.3 1397874.3 1448575.3 1397880.3 1295724.3 1448579.3 1448574.3 1448467.3 1295800.3 1422044.3 1295756.3 1448469.3 1400922.3 1400928.3 1295807.3 1455284.3 1397867.3 1773.318 1448592.3 1295803.3 1397928.3 1397866.3 1448580.3 1295795.3 1397931.3 1448524.3 1295721.3 1455294.3 1397872.3 1438872.3 1295799.3 1397934.3 1448545.3 1455269.3 1448569.3 1295775.3 1438874.3 1448497.3 1448523.3 1397886.3 1455268.3 1438878.3 1417013.3 1448570.3 1417014.3 1400926.3 1295753.3 1455286.3 1448465.3 1324229.3 1400920.3 1448559.3 1417008.3 1400886.3 1295798.3 1448468.3 1295774.3 1448546.3 1295808.3 1455288.3 1455283.3 1400881.3 1397926.3 1417011.3 1448576.3 1400938.3 1400915.3 1448584.3 1295720.3 1397937.3 1267359.3 1295760.3 1397855.3 1400870.3 1448474.3 1397871.3 1448586.3 1324284.3 1448472.3 1438870.3 1773.304 1397933.3 1402583.3 1438861.3 1295759.3 1397873.3 1408965.4 1448571.3 1417026.3 1448477.3 1438884.3 1295802.3 1295726.3 1400930.3 1400940.3 1408972.3 1448577.3 1400937.3 1295746.3 1295723.3 1295773.3 1438868.3 1397936.3 1438850.3 1417015.3 1448466.3 1324258.3 1400885.3 1295758.3 1408969.4 1438860.3 1397935.3 1438847.3 1773.333 1417029.3 1417018.3 1448572.3 1417019.3 1397862.3 1438854.3 1422100.3 1400880.3 1448463.3 1448476.3 1397876.3 1397863.3 1417023.3 1402587.3 1448464.3 1397858.3 1455285.3 1397854.3 1448462.3 1448478.3 1448609.3 1408946.4 1295727.3 1455290.3 1417027.3 1400884.3 1397861.3 1295772.3 1400889.3 1397868.3 1400939.3 1397932.3 1324243.3 1295805.3 1448530.3 1408963.4 1324261.3 1438833.3 1417017.3 1402584.3 1448470.3 1397856.3 1295744.3 1295767.3 1455295.3 1397929.3 1448471.3 1422030.3 1455278.3 1455266.3 1422095.3 1397879.3 1448595.3 1448495.3 1455293.3 1417030.3 1448582.3 1421947.3 1324235.3 1295764.3 1295751.3 1448585.3 1438867.3 1455270.3 1438845.3 1397857.3 1295771.3 1295797.3 1295769.3 1397923.3 1397859.3 1448589.3 1417031.3 1448473.3 1397885.3 1417010.3 1295801.3 1448475.3 1455289.3 1324250.3 1397925.3 1295745.3 1402585.3 1438869.3 1448479.3 1400941.3 1397864.3 1397930.3 1295757.3 1400871.3 1295776.3 1400882.3 1397853.3 1295725.3 1324237.3 1397878.3 1397875.3 1400925.3 1397927.3 1773.267';
296 :     $AdaboostValues{'Mycobacterium tuberculosis'}{ofloxacin}{SUSCEPTIBLE} = '1397919.3 1448488.3 1773.365 1773.314 1324267.3 1438862.3 1267357.3 1448560.3 1421920.3 1421993.3 1400923.3 1408955.4 1324287.3 1324222.3 1397882.3 1400891.3 1267364.3 1773.278 1773.342 1438834.3 1400879.3 1422098.3 1422064.3 1324252.3 1397918.3 1400916.3 1408947.4 1421982.3 1295782.3 1448598.3 1773.297 1448551.3 1422009.3 1448480.3 1773.308 1324281.3 1448538.3 1422008.3 1324245.3 1421921.3 1422068.3 1421990.3 1408907.4 1324278.3 1421992.3 1773.372 1421969.3 1408904.4 1455311.3 1448591.3 1455307.3 1773.305 1455274.3 1397907.3 1324271.3 1438864.3 1421986.3 1408921.4 1421945.3 1324240.3 1422092.3 1295739.3 1448554.3 1448596.3 1417009.3 1422024.3 1422016.3 1400883.3 1448505.3 1397915.3 1422069.3 1324262.3 1267360.3 1448587.3 1448594.3 1448509.3 1324280.3 1295792.3 1397917.3 1438836.3 1397888.3 1448519.3 1324274.3 1438852.3 1438843.3 1397881.3 1295763.3 1422047.3 1422073.3 1324249.3 1397887.3 1438873.3 1448498.3 1354120.3 1448604.3 1448564.3 1324260.3 1455308.3 1438865.3 1422107.3 1421977.3 1417028.3 1448491.3 1421941.3 1408926.4 1438853.3 1438842.3 1422038.3 1448544.3 1448593.3 1455263.3 1448607.3 1448563.3 1438837.3 1455287.3 1295790.3 1448516.3 1400914.3 1354112.3 1773.367 1397910.3 1448512.3 1438838.3 1422104.3 1448492.3 1397913.3 1397916.3 1773.277 1324273.3 1324251.3 1448555.3 1324282.3 1448506.3 1422087.3 1448599.3 1448481.3 1438846.3 1438848.3 1400924.3 1400872.3 1773.271 1773.331 1455276.3 1448526.3 1408945.4 1773.275 1397920.3 1421957.3 1448565.3 1438856.3 1773.326 1438851.3 1397865.3 1448501.3 1773.284 1448606.3 1422055.3 1422076.3 1455291.3 1408912.4 1397922.3 1773.344 1267356.3 1422054.3 1438871.3 1773.319 1295791.3 1267362.3 1295796.3 1408913.4 1438859.3 1324232.3 1324272.3 1455305.3 1422040.3 1295781.3 1448547.3 1397884.3 1773.352 1324253.3 1773.281 1421932.3 1421973.3 1324231.3 1438858.3 1773.354 1448484.3 1438866.3 1422089.3 1422022.3 1397921.3 1422012.3 1438849.3 1773.337 1400877.3 1397883.3 1421954.3 1448561.3 1422061.3 1773.370 1773.287 1422042.3 1421997.3 1448602.3 1448567.3 1448527.3 1438863.3 1422084.3 1324218.3 1422049.3 1422018.3 1324255.3 1773.335 1422080.3 1408932.4 1422052.3 1448568.3 1421975.3 1397908.3 1324279.3 1448597.3 1422014.3 1324283.3 1324228.3 1448508.3 1773.282 1324236.3 1324230.3 1773.296 1400873.3 1324239.3 1438841.3 1422026.3 1421971.3 1438844.3 1421951.3 1408939.4 1400875.3 1448590.3';
297 :     $AdaboostValues{'Mycobacterium tuberculosis'}{ofloxacin}{AUC} = '0.833';
298 :     $AdaboostValues{'Mycobacterium tuberculosis'}{ofloxacin}{F1} = '0.761';
299 :     $AdaboostValues{'Mycobacterium tuberculosis'}{ofloxacin}{ACCURACY} = '0.791';
300 :     $AdaboostValues{'Mycobacterium tuberculosis'}{ofloxacin}{SOURCES} = 'TB-ARC initiative, Broad Institute (broadinstitute.org); PMID: 25599400';
301 :     $AdaboostValues{'Mycobacterium tuberculosis'}{ofloxacin}{FUNCTION} = 'Ofloxacin resistance predicted region';
302 :    
303 :    
304 :     # rifampicin
305 :    
306 :     $AdaboostValues{'Mycobacterium tuberculosis'}{rifampicin}{ANTIBIOTICS} = 'rifampicin';
307 :     $AdaboostValues{'Mycobacterium tuberculosis'}{rifampicin}{ABBREVIATIONS} = 'RA';
308 :     my $MTB_RA = <<"End_of_MTB_RA";
309 :     0.610324 AACAGTCGGCGCTTGTGGGTCAACCCCGACA
310 :     0.784867 GGACCGGGGGCGGTGGCGGCGTTGGTGGGGA GACCGGGGGCGGTGGCGGCGTTGGTGGGGAC
311 :     0.517924 GCACCGGAACCGGTAAGGACGCGATCACCAC
312 :     0.312755 AGCGCCAACAGTCGGCGCTTGTGGGTCAACC ACCGCCGGGCCCCAGCGCCAACAGTCGGCGC ACGTGACAGACCGCCGGGCCCCAGCGCCAAC AGCGCCGACTGTTGGCGCTGGGGCCCGGCGG CGGGGTTGACCCACAAGCGCCGACTGTTGGC CTGTTGGCGCTGGGGCCCGGCGGTCTGTCAC CCCACAAGCGCCGACTGTTGGCGCTGGGGCC CAACAGTCGGCGCTTGTGGGTCAACCCCGAC AAGCGCCGACTGTTGGCGCTGGGGCCCGGCG ACAAGCGCCGACTGTTGGCGCTGGGGCCCGG ACAGACCGCCGGGCCCCAGCGCCAACAGTCG ACCCACAAGCGCCGACTGTTGGCGCTGGGGC AGACCGCCGGGCCCCAGCGCCAACAGTCGGC CAAGCGCCGACTGTTGGCGCTGGGGCCCGGC CACAAGCGCCGACTGTTGGCGCTGGGGCCCG CAGACCGCCGGGCCCCAGCGCCAACAGTCGG CAGCGCCAACAGTCGGCGCTTGTGGGTCAAC CCAACAGTCGGCGCTTGTGGGTCAACCCCGA CCACAAGCGCCGACTGTTGGCGCTGGGGCCC CCAGCGCCAACAGTCGGCGCTTGTGGGTCAA CCCAGCGCCAACAGTCGGCGCTTGTGGGTCA CGCCAACAGTCGGCGCTTGTGGGTCAACCCC CGCCGACTGTTGGCGCTGGGGCCCGGCGGTC GACAGACCGCCGGGCCCCAGCGCCAACAGTC GCGCCAACAGTCGGCGCTTGTGGGTCAACCC ACTGTTGGCGCTGGGGCCCGGCGGTCTGTCA CACGTGACAGACCGCCGGGCCCCAGCGCCAA CGTGACAGACCGCCGGGCCCCAGCGCCAACA TCACGTGACAGACCGCCGGGCCCCAGCGCCA CCCCAGCGCCAACAGTCGGCGCTTGTGGGTC
313 :     0.382792 GGTGGCGGCGGCGCCGGCGGCGCCGGCGGCA
314 :     0.293399 GCCGGCTGGTATTCGCCGGTGTCCCCGGGGA CCGGCTGGTATTCGCCGGTGTCCCCGGGGAC CGGGGACACCGGCGAATACCAGCCGGCCAGC CCCCGGGGACACCGGCGAATACCAGCCGGCC CCGCTGGCCGGCTGGTATTCGCCGGTGTCCC CGCTGGCCGGCTGGTATTCGCCGGTGTCCCC CGGCTGGTATTCGCCGGTGTCCCCGGGGACC CCGGGGACACCGGCGAATACCAGCCGGCCAG AGGTCCCCGGGGACACCGGCGAATACCAGCC CCCGGGGACACCGGCGAATACCAGCCGGCCA
315 :     0.193563 CATCGCCACCAGCGCCGCCGGTGCCGCCGGC CCATCGCCACCAGCGCCGCCGGTGCCGCCGG ACGCCATCGCCACCAGCGCCGCCGGTGCCGC CGCCATCGCCACCAGCGCCGCCGGTGCCGCC CGGCACCGGCGGCGCTGGTGGCGATGGCGTC CGGCGGCACCGGCGGCGCTGGTGGCGATGGC ATCGCCACCAGCGCCGCCGGTGCCGCCGGCG
316 :     0.211412 AGAGTCTCCGGACTCACCGGGGCGGTTCATC
317 :     0.208819 GCGGTGGCGGTGGCGGTCAACTGCGGGGCCA GGCCCCGCAGTTGACCGCCACCGCCACCGCC
318 :     0.210286 CTCGTCGAGCACTCACCGGTGAACCGCTAGC GGCTAGCGGTTCACCGGTGAGTGCTCGACGA
319 :     End_of_MTB_RA
320 :     my %load = &Load_Adaboost ($MTB_RA);
321 :     $AdaboostValues{'Mycobacterium tuberculosis'}{rifampicin}{ADABOOST} = \%load;
322 :     $AdaboostValues{'Mycobacterium tuberculosis'}{rifampicin}{RESISTANT} = '1408905.4 1438837.3 1448562.3 1422026.3 1295782.3 1324230.3 1448517.3 1773.284 1408916.4 1448498.3 1448602.3 1448527.3 1438836.3 1448484.3 1397877.3 1448567.3 1324252.3 1422036.3 1324280.3 1354120.3 1773.275 1324253.3 1448538.3 1324225.3 1422014.3 1448568.3 1324249.3 1448780.3 1421941.3 1773.282 1295796.3 1422059.3 1421975.3 1773.296 1438851.3 1324287.3 1267357.3 1397918.3 1408913.4 1448607.3 1400912.3 1422034.3 1400916.3 1448563.3 1773.271 1421986.3 1295763.3 1438867.3 1448598.3 1408967.4 1422040.3 1408936.4 1448411.3 1773.278 1422079.3 1422045.3 1422073.3 1448529.3 1448662.3 1408945.4 1408963.4 1295798.3 1422021.3 1421962.3 1421971.3 1397881.3 1397911.3 1438841.3 1421988.3 1324255.3 1448544.3 1448702.3 1324235.3 1438842.3 1397912.3 1408969.4 1417012.3 1448564.3 1421966.3 1773.276 1448501.3 1421957.3 1448508.3 1400898.3 1422055.3 1448650.3 1421921.3 1438835.3 1422038.3 1295801.3 1422008.3 1773.314 1421993.3 1400931.3 1422042.3 1267355.3 1422087.3 1421990.3 1438856.3 1408928.4 1408974.4 1448552.3 1408965.4 1448695.3 1324282.3 1422104.3 1408947.4 1773.297 1408906.4 1421937.3 1421932.3 1438878.3 1354147.3 1448599.3 1438834.3 1448606.3 1448596.3 1448514.3 1295791.3 1408921.4 1422012.3 1773.352 1408935.4 1448519.3 1408919.4 1422092.3 1448533.3 1421996.3 1421982.3 1421992.3 1421968.3 1448743.3 1448565.3 1448512.3 1422024.3 1397919.3 1267362.3 1408948.4 1422068.3 1324231.3 1408926.4 1448560.3 1421977.3 1397917.3 1408939.4 1422061.3 1324240.3 1324271.3 1408927.4 1438884.3 1422064.3 1448548.3 1422022.3 1397915.3 1295799.3 1422054.3 1397865.3 1438846.3 1448661.3 1448490.3 1422049.3 1422005.3 1267360.3 1422084.3 1448716.3 1408930.4 1448516.3 1397910.3 1408955.4 1295790.3 1422080.3 1408912.4 1267361.3 1397914.3 1438865.3 1448781.3 1422085.3 1448491.3 1324218.3 1267364.3 1400885.3 1448784.3 1422016.3 1421928.3 1422001.3 1418254.3 1438843.3 1400879.3 1324266.3 1324241.3 1267363.3 1422009.3 1448555.3 1422076.3 1448526.3 1448545.3 1324223.3 1422065.3 1438871.3 1448481.3 1324286.3 1421951.3 1324267.3 1324254.3 1448492.3 1448480.3 1448605.3 1421956.3 1421973.3 1324239.3 1400873.3 1448744.3 1422093.3 1324245.3 1324274.3 1448785.3 1324227.3 1448547.3 1422069.3 1402584.3 1295781.3 1448590.3 1422082.3 1438840.3 1324220.3 1422098.3 1324273.3 1448812.3 1354112.3 1324265.3 1408972.3 1448551.3 1418253.3 1324228.3 1397916.3 1438866.3 1422018.3 1448550.3 1448513.3 1324242.3 1408932.4 1448509.3 1324277.3 1448813.3 1448827.3 1421954.3 1408904.4 1422013.3';
323 :     $AdaboostValues{'Mycobacterium tuberculosis'}{rifampicin}{SUSCEPTIBLE} = '1448714.3 1448729.3 1448561.3 1448728.3 1773.317 1448794.3 1773.363 1295802.3 1448671.3 1397909.3 1448706.3 1354141.3 1397908.3 1448800.3 1354153.3 1773.366 1448626.3 1448745.3 1448656.3 1295800.3 1773.355 1448822.3 1448829.3 1773.274 1402585.3 1448682.3 1448619.3 1448641.3 1448680.3 1448760.3 1448792.3 1408907.4 1448789.3 1448764.3 1448807.3 1448837.3 1773.358 1400920.3 1448687.3 1448678.3 1773.300 1448772.3 1448712.3 1773.323 1448753.3 1448655.3 1448604.3 1448688.3 1448635.3 1448608.3 1773.361 1354139.3 1448815.3 1448838.3 1448674.3 1773.347 1448690.3 1448766.3 1448684.3 1448668.3 1448771.3 1402587.3 1448725.3 1448834.3 1773.292 1448699.3 1448768.3 1448646.3 1354108.3 1448803.3 1448817.3 1448651.3 1448648.3 1354150.3 1354151.3 1448796.3 1448790.3 1448683.3 1773.285 1354155.3 1448727.3 1448594.3 1354152.3 1324261.3 1448778.3 1448763.3 1448620.3 1448819.3 1448665.3 1773.368 1448659.3 1773.356 1448694.3 1397907.3 1773.295 1448731.3 1448811.3 1448754.3 1448708.3 1408952.4 1408964.4 1448701.3 1448681.3 1324278.3 1448828.3 1295797.3 1448747.3 1448624.3 1773.298 1448758.3 1448622.3 1324262.3 1448629.3 1448664.3 1448704.3 1397913.3 1448705.3 1448740.3 1448717.3 1448677.3 1448633.3 1448776.3 1448737.3 1773.265 1448830.3 1448814.3 1773.372 1448485.3 1773.349 1448795.3 1397921.3 1448676.3 1773.294 1448657.3 1397923.3 1448752.3 1448697.3 1448615.3 1773.341 1448735.3 1448679.3 1448787.3 1354129.3 1448797.3 1448692.3 1773.324 1773.268 1354101.3 1448696.3 1448630.3 1402586.3 1448649.3 1448632.3 1354143.3 1773.359 1448774.3 1448611.3 1448808.3 1448612.3 1448783.3 1295808.3 1773.283 1773.309 1295804.3 1324281.3 1397932.3 1448756.3 1448831.3 1448730.3 1448786.3 1448627.3 1448721.3 1773.289 1295807.3 1354140.3 1354131.3 1448762.3 1354145.3 1448802.3 1448755.3 1773.301 1354159.3 1448798.3 1295806.3 1448836.3 1448703.3 1448669.3 1354156.3 1773.316 1773.290 1448707.3 1354142.3 1448691.3 1354157.3 1448638.3 1354146.3 1448765.3 1773.322 1448711.3 1448654.3 1448816.3 1448670.3 1448723.3 1448593.3 1773.310 1354148.3 1448709.3 1773.328 1773.346 1448757.3 1773.369 1448663.3 1448693.3 1448631.3 1448643.3 1295803.3 1773.273 1448710.3 1448769.3 1448482.3 1448733.3 1773.315 1773.351 1448801.3 1448625.3 1448653.3 1773.364 1448689.3 1448739.3 1448673.3 1448613.3 1448618.3 1773.345 1773.279 1354135.3 1448639.3 1448666.3 1448395.3 1448645.3 1448713.3 1354137.3 1354122.3 1448642.3 1324222.3 1448700.3 1773.280 1448825.3 1773.357';
324 :     $AdaboostValues{'Mycobacterium tuberculosis'}{rifampicin}{AUC} = '0.932';
325 :     $AdaboostValues{'Mycobacterium tuberculosis'}{rifampicin}{F1} = '0.870';
326 :     $AdaboostValues{'Mycobacterium tuberculosis'}{rifampicin}{ACCURACY} = '0.858';
327 :     $AdaboostValues{'Mycobacterium tuberculosis'}{rifampicin}{SOURCES} = 'TB-ARC initiative, Broad Institute (broadinstitute.org); PMID: 25599400';
328 :     $AdaboostValues{'Mycobacterium tuberculosis'}{rifampicin}{FUNCTION} = 'Rifampicin resistance predicted region';
329 :    
330 :     # streptomycin
331 :    
332 :     $AdaboostValues{'Mycobacterium tuberculosis'}{streptomycin}{ANTIBIOTICS} = 'streptomycin';
333 :     $AdaboostValues{'Mycobacterium tuberculosis'}{streptomycin}{ABBREVIATIONS} = 'S';
334 :     my $MTB_S = <<"End_of_MTB_S";
335 :     0.386108 CGTGTACACCACCACTCCGAGGAAGCCGAAC ATGCACCCGCGTGTACACCACCACTCCGAGG CACCACCACTCCGAGGAAGCCGAACTCGGCG CCGAGGAAGCCGAACTCGGCGCTTCGGAAGG CACCCGCGTGTACACCACCACTCCGAGGAAG AACCTTCCGAAGCGCCGAGTTCGGCTTCCTC AAGCGCCGAGTTCGGCTTCCTCGGAGTGGTG ACACCACCACTCCGAGGAAGCCGAACTCGGC ACCACTCCGAGGAAGCCGAACTCGGCGCTTC ACCTTCCGAAGCGCCGAGTTCGGCTTCCTCG ACTCCGAGGAAGCCGAACTCGGCGCTTCGGA CTCCGAGGAAGCCGAACTCGGCGCTTCGGAA CTTCCGAAGCGCCGAGTTCGGCTTCCTCGGA GCAACCTTCCGAAGCGCCGAGTTCGGCTTCC CCCGCGTGTACACCACCACTCCGAGGAAGCC CCGCGTGTACACCACCACTCCGAGGAAGCCG CTCGGAGTGGTGGTGTACACGCGGGTGCATA GCACCCGCGTGTACACCACCACTCCGAGGAA AGTTCGGCTTCCTCGGAGTGGTGGTGTACAC CGCGTGTACACCACCACTCCGAGGAAGCCGA GCGTGTACACCACCACTCCGAGGAAGCCGAA CGAGTTCGGCTTCCTCGGAGTGGTGGTGTAC AGGAAGCCGAACTCGGCGCTTCGGAAGGTTG ACCCGCGTGTACACCACCACTCCGAGGAAGC CCACTCCGAGGAAGCCGAACTCGGCGCTTCG GAGTTCGGCTTCCTCGGAGTGGTGGTGTACA CCGAGTTCGGCTTCCTCGGAGTGGTGGTGTA TCCTCGGAGTGGTGGTGTACACGCGGGTGCA CACTCCGAGGAAGCCGAACTCGGCGCTTCGG AGCGCCGAGTTCGGCTTCCTCGGAGTGGTGG ACCACCACTCCGAGGAAGCCGAACTCGGCGC
336 :     0.341793 CCACCCGCACGGCGACGCGTCGATCTACGAC ACCACCCGCACGGCGACGCGTCGATCTACGA CACCCGCACGGCGACGCGTCGATCTACGACA
337 :     0.199594 GGGGCCACGATCACCAACGACATCACAGACC CACGATCACCAACGACATCACAGACCTCCCG CCACGATCACCAACGACATCACAGACCTCCC CCGGGGCCACGATCACCAACGACATCACAGA CGGGGCCACGATCACCAACGACATCACAGAC GAGGTCTGTGATGTCGTTGGTGATCGTGGCC GCCACGATCACCAACGACATCACAGACCTCC AGGTCTGTGATGTCGTTGGTGATCGTGGCCC
338 :     0.193768 GCACCGGAACCGGTAAGGACGCGATCACCAC
339 :     0.188485 GCACACCAGGCAGGTCCCTCACCCGGCCGCC CCTCACCCGGCCGCCGCGCACCAGCACCATC CAGGTCCCTCACCCGGCCGCCGCGCACCAGC ACCAGGCAGGTCCCTCACCCGGCCGCCGCGC CACCAGGCAGGTCCCTCACCCGGCCGCCGCG CGGCCGGGTGAGGGACCTGCCTGGTGTGCGC ACACCAGGCAGGTCCCTCACCCGGCCGCCGC AGCGCACACCAGGCAGGTCCCTCACCCGGCC CACACCAGGCAGGTCCCTCACCCGGCCGCCG CCGGGTGAGGGACCTGCCTGGTGTGCGCTAC CGCACACCAGGCAGGTCCCTCACCCGGCCGC CGGGTGAGGGACCTGCCTGGTGTGCGCTACA CTTGTAGCGCACACCAGGCAGGTCCCTCACC GAGGGACCTGCCTGGTGTGCGCTACAAGATC GCCGGGTGAGGGACCTGCCTGGTGTGCGCTA GGGTGAGGGACCTGCCTGGTGTGCGCTACAA GTGAGGGACCTGCCTGGTGTGCGCTACAAGA AGGGACCTGCCTGGTGTGCGCTACAAGATCA ATGATCTTGTAGCGCACACCAGGCAGGTCCC AGGCAGGTCCCTCACCCGGCCGCCGCGCACC CCAGGCAGGTCCCTCACCCGGCCGCCGCGCA CTGGTGCGCGGCGGCCGGGTGAGGGACCTGC GGCAGGTCCCTCACCCGGCCGCCGCGCACCA AGGTCCCTCACCCGGCCGCCGCGCACCAGCA ATGGTGCTGGTGCGCGGCGGCCGGGTGAGGG GGTGCTGGTGCGCGGCGGCCGGGTGAGGGAC TCCCTCACCCGGCCGCCGCGCACCAGCACCA CAGGCAGGTCCCTCACCCGGCCGCCGCGCAC ATCTTGTAGCGCACACCAGGCAGGTCCCTCA CGATGGTGCTGGTGCGCGGCGGCCGGGTGAG GGTCCCTCACCCGGCCGCCGCGCACCAGCAC
340 :     0.211348 AACCGGTTTTTCGCGATCGTCGTCAACGAGG CAAGCTCCTCAACCGGTTTTTCGCGATCGTC CCGGTTTTTCGCGATCGTCGTCAACGAGGTC AAGCTCCTCAACCGGTTTTTCGCGATCGTCG ACGACGATCGCGAAAAACCGGTTGAGGAGCT ACGATCGCGAAAAACCGGTTGAGGAGCTTGA CCTCAACCGGTTTTTCGCGATCGTCGTCAAC CGTTGACGACGATCGCGAAAAACCGGTTGAG CTCCTCAACCGGTTTTTCGCGATCGTCGTCA TCAACCGGTTTTTCGCGATCGTCGTCAACGA TCCTCAACCGGTTTTTCGCGATCGTCGTCAA CGACCTCGTTGACGACGATCGCGAAAAACCG CAACCGGTTTTTCGCGATCGTCGTCAACGAG ACCGGTTTTTCGCGATCGTCGTCAACGAGGT GACGACGATCGCGAAAAACCGGTTGAGGAGC
341 :     0.187606 GCGTCGAGGATTTCCTGAACGTCCTGCCAGA CGTCCTGCCAGAGCTTGGGGTTCTTGCTGCC CTGCGCTCTGCGGGAAGTAGGTCCGCTCAGA AGCTCTGGCAGGACGTTCAGGAAATCCTCGA CTGGCAGCAAGAACCCCAAGCTCTGGCAGGA ATCCTTGTGCGCTGCGCGCTGGTGCGATTCA CATGCGGATCTCCCATGAATCGCACCAGCGC CGAGCCCACGGGCGCCCTCGGCCTGACCGTC GCCCGTGGGCTCGCCCGTGAGCGCTCGCGCC CGTCGAGGATTTCCTGAACGTCCTGCCAGAG CTACTTCCCGCAGAGCGCAGCGGTCACCCCC GGGCGAGCCCACGGGCGCCCTCGGCCTGACC GCTGCGCGCTGGTGCGATTCATGGGAGATCC AAGCTCTGGCAGGACGTTCAGGAAATCCTCG ACCGCTGCGCTCTGCGGGAAGTAGGTCCGCT CGGACCTACTTCCCGCAGAGCGCAGCGGTCA CATCACGATATCCTTGTGCGCTGCGCGCTGG CTGCTGGCGCGAGCGCTCACGGGCGAGCCCA ACGGGCGCCCTCGGCCTGACCGTCCAGGTGC ACGGGGGTGACCGCTGCGCTCTGCGGGAAGT ACCTGGACGGTCAGGCCGAGGGCGCCCGTGG CTGGACGGTCAGGCCGAGGGCGCCCGTGGGC ACCTACTTCCCGCAGAGCGCAGCGGTCACCC CGATATCCTTGTGCGCTGCGCGCTGGTGCGA CCCGTGGGCTCGCCCGTGAGCGCTCGCGCCA CTCTGCGGGAAGTAGGTCCGCTCAGACCAGC CGGATCTCCCATGAATCGCACCAGCGCGCAG AACCCCAAGCTCTGGCAGGACGTTCAGGAAA CACGGGCGAGCCCACGGGCGCCCTCGGCCTG GAGCCCACGGGCGCCCTCGGCCTGACCGTCC ACCTGGCAGCAAGAACCCCAAGCTCTGGCAG CTCCCATGAATCGCACCAGCGCGCAGCGCAC GTGGGCTCGCCCGTGAGCGCTCGCGCCAGCA GCTCTGGCAGGACGTTCAGGAAATCCTCGAC CCGCTGCGCTCTGCGGGAAGTAGGTCCGCTC ACGGGCGAGCCCACGGGCGCCCTCGGCCTGA AGGCCGAGGGCGCCCGTGGGCTCGCCCGTGA AGGGCGCCCGTGGGCTCGCCCGTGAGCGCTC CGAGCGCTCACGGGCGAGCCCACGGGCGCCC CGCCCGTGGGCTCGCCCGTGAGCGCTCGCGC CGCGAGCGCTCACGGGCGAGCCCACGGGCGC CGGGCGAGCCCACGGGCGCCCTCGGCCTGAC CGGTCAGGCCGAGGGCGCCCGTGGGCTCGCC CGTGGGCTCGCCCGTGAGCGCTCGCGCCAGC CTCACGGGCGAGCCCACGGGCGCCCTCGGCC GCCGAGGGCGCCCGTGGGCTCGCCCGTGAGC GCGAGCGCTCACGGGCGAGCCCACGGGCGCC AATCGCACCAGCGCGCAGCGCACAAGGATAT ACGATATCCTTGTGCGCTGCGCGCTGGTGCG ACTGAGCATCACGATATCCTTGTGCGCTGCG AGCATCACGATATCCTTGTGCGCTGCGCGCT CACGATATCCTTGTGCGCTGCGCGCTGGTGC CAGCGCGCAGCGCACAAGGATATCGTGATGC CGCGCAGCGCACAAGGATATCGTGATGCTCA CTGAGCATCACGATATCCTTGTGCGCTGCGC CGGGGGTGACCGCTGCGCTCTGCGGGAAGTA CGGGTACCCGAGCTGGTCTGAGCGGACCTAC AAGTAGGTCCGCTCAGACCAGCTCGGGTACC ACCCGAGCTGGTCTGAGCGGACCTACTTCCC AGCTGGTCTGAGCGGACCTACTTCCCGCAGA CCGAGCTGGTCTGAGCGGACCTACTTCCCGC CGAGCTGGTCTGAGCGGACCTACTTCCCGCA CGCTCTGCGGGAAGTAGGTCCGCTCAGACCA CGCTGCGCTCTGCGGGAAGTAGGTCCGCTCA CTGAGCGGACCTACTTCCCGCAGAGCGCAGC CTGCGGGAAGTAGGTCCGCTCAGACCAGCTC CTGGTCTGAGCGGACCTACTTCCCGCAGAGC GACCGCTGCGCTCTGCGGGAAGTAGGTCCGC GACCTACTTCCCGCAGAGCGCAGCGGTCACC GCGCTCTGCGGGAAGTAGGTCCGCTCAGACC GGAAGTAGGTCCGCTCAGACCAGCTCGGGTA GGACCTACTTCCCGCAGAGCGCAGCGGTCAC GTCTGAGCGGACCTACTTCCCGCAGAGCGCA CCCAAGCTCTGGCAGGACGTTCAGGAAATCC AGCCCACGGGCGCCCTCGGCCTGACCGTCCA CACCTGGACGGTCAGGCCGAGGGCGCCCGTG CCCACGGGCGCCCTCGGCCTGACCGTCCAGG CAACACACCTGGCAGCAAGAACCCCAAGCTC AACGTCCTGCCAGAGCTTGGGGTTCTTGCTG AAGAACCCCAAGCTCTGGCAGGACGTTCAGG ACACACCTGGCAGCAAGAACCCCAAGCTCTG ACACCTGGCAGCAAGAACCCCAAGCTCTGGC ACGTCCTGCCAGAGCTTGGGGTTCTTGCTGC AGCAAGAACCCCAAGCTCTGGCAGGACGTTC CAAGAACCCCAAGCTCTGGCAGGACGTTCAG CACACCTGGCAGCAAGAACCCCAAGCTCTGG CACCTGGCAGCAAGAACCCCAAGCTCTGGCA GAACCCCAAGCTCTGGCAGGACGTTCAGGAA GCAAGAACCCCAAGCTCTGGCAGGACGTTCA GTCCTGCCAGAGCTTGGGGTTCTTGCTGCCA ATCTCCCATGAATCGCACCAGCGCGCAGCGC ATGAATCGCACCAGCGCGCAGCGCACAAGGA ATGCGGATCTCCCATGAATCGCACCAGCGCG CATGAATCGCACCAGCGCGCAGCGCACAAGG CCATGAATCGCACCAGCGCGCAGCGCACAAG CCCATGAATCGCACCAGCGCGCAGCGCACAA CGCTGCGCGCTGGTGCGATTCATGGGAGATC GCGCGCTGGTGCGATTCATGGGAGATCCGCA GCGGATCTCCCATGAATCGCACCAGCGCGCA TCTCCCATGAATCGCACCAGCGCGCAGCGCA CCTGCCAGAGCTTGGGGTTCTTGCTGCCAGG CCGAGGGCGCCCGTGGGCTCGCCCGTGAGCG CACCAGCGCGCAGCGCACAAGGATATCGTGA GAATCGCACCAGCGCGCAGCGCACAAGGATA AGTAGGTCCGCTCAGACCAGCTCGGGTACCC CCGTGGGCTCGCCCGTGAGCGCTCGCGCCAG AGCGCTCACGGGCGAGCCCACGGGCGCCCTC AGCTTGGGGTTCTTGCTGCCAGGTGTGTTGG CCCGAGCTGGTCTGAGCGGACCTACTTCCCG ACGGTCAGGCCGAGGGCGCCCGTGGGCTCGC AGGATTTCCTGAACGTCCTGCCAGAGCTTGG ACGGGTACCCGAGCTGGTCTGAGCGGACCTA ATCGCACCAGCGCGCAGCGCACAAGGATATC AGAACCCCAAGCTCTGGCAGGACGTTCAGGA CGAGGGCGCCCGTGGGCTCGCCCGTGAGCGC AACACACCTGGCAGCAAGAACCCCAAGCTCT ACCCCAAGCTCTGGCAGGACGTTCAGGAAAT ACCAGCGCGCAGCGCACAAGGATATCGTGAT CCTACTTCCCGCAGAGCGCAGCGGTCACCCC CAAGCTCTGGCAGGACGTTCAGGAAATCCTC TCCCATGAATCGCACCAGCGCGCAGCGCACA GAGCATCACGATATCCTTGTGCGCTGCGCGC GAAGTAGGTCCGCTCAGACCAGCTCGGGTAC CCCCAAGCTCTGGCAGGACGTTCAGGAAATC
342 :     0.191986 ACAACACCACCACCGCCGCCGCCGGCACCAC GACAACACCACCACCGCCGCCGCCGGCACCA
343 :     0.144418 CCGTTTCGGCGTGCATCGTCGCCGGGCTAGG
344 :     0.133788 CAAAAGTCACTCGCGGTCAACACATCACGAA CCAAAAGTCACTCGCGGTCAACACATCACGA CCCAAAAGTCACTCGCGGTCAACACATCACG
345 :     End_of_MTB_S
346 :     my %load = &Load_Adaboost ($MTB_S);
347 :     $AdaboostValues{'Mycobacterium tuberculosis'}{streptomycin}{ADABOOST} = \%load;
348 :     $AdaboostValues{'Mycobacterium tuberculosis'}{streptomycin}{RESISTANT} = '1422073.3 1397917.3 1448564.3 1422089.3 1397908.3 1448538.3 1455263.3 1455269.3 1773.283 1421969.3 1324253.3 1438843.3 1438867.3 1324267.3 1422012.3 1400877.3 1447458.3 1324255.3 1422049.3 1324283.3 1324248.3 1324268.3 1422016.3 1354142.3 1773.359 1447493.3 1324239.3 1448764.3 1324244.3 1421986.3 1324246.3 1421973.3 1447465.3 1324230.3 1448554.3 1773.366 1447484.3 1354151.3 1295791.3 1418254.3 1324261.3 1397865.3 1447476.3 1773.343 1773.344 1455276.3 1324252.3 1438871.3 1448708.3 1267357.3 1421941.3 1324279.3 1773.278 1447475.3 1397910.3 1421982.3 1408909.4 1448645.3 1448481.3 1447437.3 1422084.3 1397916.3 1397919.3 1421983.3 1421975.3 1408932.4 1295739.3 1422072.3 1422014.3 1448544.3 1324232.3 1324219.3 1773.370 1438865.3 1455292.3 1397913.3 1455305.3 1773.296 1448735.3 1773.339 1448715.3 1267364.3 1324274.3 1422009.3 1448488.3 1422026.3 1773.367 1324281.3 1773.308 1773.287 1422064.3 1397932.3 1438846.3 1773.352 1773.372 1448728.3 1324226.3 1448604.3 1447452.3 1295775.3 1773.331 1438842.3 1422082.3 1447507.3 1455307.3 1354101.3 1448801.3 1773.335 1354124.3 1448768.3 1324218.3 1447440.3 1324249.3 1448555.3 1295792.3 1408963.4 1422092.3 1354111.3 1295796.3 1422038.3 1354122.3 1773.351 1438837.3 1354135.3 1422069.3 1324233.3 1773.300 1448506.3 1324231.3 1422068.3 1438853.3 1397915.3 1422080.3 1324222.3 1324224.3 1448505.3 1354114.3 1324276.3 1422008.3 1773.332 1773.281 1447444.3 1354115.3 1448560.3 1448642.3 1447502.3 1448836.3 1422061.3 1422040.3 1455311.3 1447441.3 1438836.3 1448590.3 1448547.3 1422098.3 1448593.3 1408913.4 1422076.3 1354129.3 1324263.3 1324285.3 1418253.3 1438858.3 1773.271 1324251.3 1773.275 1422042.3 1773.309 1773.361 1397923.3 1422059.3 1408948.4 1438838.3 1455308.3 1422022.3 1397887.3 1408955.4 1400928.3 1447495.3 1447523.3 1773.305 1455270.3 1773.325 1448753.3 1324240.3 1773.326 1402583.3 1773.342 1773.354 1448680.3 1397914.3 1455274.3 1448480.3 1773.286 1324245.3 1448599.3 1422104.3 1455268.3 1267360.3 1421990.3 1448519.3 1448607.3 1447463.3 1422018.3 1408947.4 1447521.3 1455293.3 1447503.3 1324228.3 1295790.3 1421997.3 1448631.3 1324256.3 1295763.3 1448691.3 1397918.3 1422052.3 1773.319 1447486.3 1422054.3 1448395.3 1447459.3 1455291.3 1438848.3 1438862.3 1448512.3 1447514.3 1448526.3 1397881.3 1773.301 1773.284 1448484.3 1422005.3 1422055.3 1448491.3 1421977.3 1448596.3 1422024.3 1397907.3 1448501.3 1422047.3 1421992.3 1448565.3 1421993.3 1773.314 1421957.3 1448594.3 1773.297 1422087.3 1448838.3';
349 :     $AdaboostValues{'Mycobacterium tuberculosis'}{streptomycin}{SUSCEPTIBLE} = '1417009.3 1448514.3 1448551.3 1397853.3 1408939.4 1295802.3 1447456.3 1417015.3 1448816.3 1295798.3 1438884.3 1422034.3 1422045.3 1408912.4 1402585.3 1448784.3 1397884.3 1295806.3 1324282.3 1448478.3 1400915.3 1447470.3 1354128.3 1773.316 1773.276 1397920.3 1448467.3 1295808.3 1400883.3 1295804.3 1448492.3 1421988.3 1438854.3 1408936.4 1773.347 1448689.3 1448663.3 1400884.3 1448585.3 1324278.3 1448527.3 1408918.4 1448786.3 1400879.3 1447467.3 1448650.3 1447447.3 1448509.3 1438841.3 1400925.3 1400930.3 1400916.3 1448812.3 1448785.3 1438878.3 1422079.3 1448568.3 1448808.3 1448469.3 1400870.3 1354147.3 1448781.3 1408919.4 1448517.3 1447473.3 1447450.3 1447477.3 1408967.4 1408972.3 1447464.3 1324273.3 1448508.3 1417031.3 1448822.3 1448641.3 1422036.3 1448670.3 1324280.3 1295781.3 1448516.3 1448567.3 1397911.3 1408943.4 1448762.3 1408964.4 1447513.3 1448780.3 1417011.3 1448695.3 1447482.3 1417018.3 1438835.3 1422021.3 1448756.3 1421996.3 1447508.3 1448792.3 1455287.3 1397873.3 1397888.3 1448743.3 1448498.3 1447517.3 1448712.3 1448608.3 1417019.3 1400889.3 1422001.3 1400871.3 1397886.3 1400941.3 1408952.4 1448659.3 1448798.3 1397882.3 1402587.3 1397912.3 1417027.3 1773.345 1448690.3 1422013.3 1448749.3 1438856.3 1448474.3 1448598.3 1397924.3 1421956.3 1448807.3 1324287.3 1417026.3 1408945.4 1400898.3 1421962.3 1400885.3 1448673.3 1354152.3 1397885.3 1408904.4 1448482.3 1773.282 1448627.3 1447509.3 1447466.3 1438887.3 1417017.3 1400912.3 1448783.3 1354103.3 1397909.3 1408916.4 1417014.3 1402586.3 1422093.3 1417008.3 1448703.3 1448704.3 1422044.3 1448693.3 1448730.3 1397883.3 1295807.3 1448618.3 1408906.4 1448681.3 1448529.3 1773.310 1324271.3 1295800.3 1408965.4 1447500.3 1422065.3 1438834.3 1448687.3 1447522.3 1447436.3 1422095.3 1448465.3 1354148.3 1448694.3 1448485.3 1417013.3 1438851.3 1448563.3 1324236.3 1400935.3 1408907.4 1400875.3 1448561.3 1421937.3 1447435.3 1448646.3 1400937.3 1773.328 1417023.3 1448813.3 1448661.3 1421966.3 1408969.4 1448552.3 1448569.3 1438866.3 1448562.3 1408926.4 1295799.3 1448702.3 1448605.3 1354108.3 1448834.3 1448797.3 1421928.3 1448606.3 1402584.3 1400922.3 1447485.3 1448550.3 1267362.3 1438844.3 1448744.3 1354139.3 1448602.3 1448731.3 1438832.3 1773.294 1447516.3 1448622.3 1448662.3 1400873.3 1421968.3 1422085.3 1397921.3 1448545.3 1417010.3 1295782.3 1417030.3 1438863.3 1324262.3 1448471.3 1448576.3 1295797.3 1354131.3 1324235.3 1448827.3 1448490.3 1448750.3 1354149.3 1295801.3 1400880.3 1438840.3 1448729.3 1448716.3';
350 :     $AdaboostValues{'Mycobacterium tuberculosis'}{streptomycin}{AUC} = '0.795';
351 :     $AdaboostValues{'Mycobacterium tuberculosis'}{streptomycin}{F1} = '0.722';
352 :     $AdaboostValues{'Mycobacterium tuberculosis'}{streptomycin}{ACCURACY} = '0.712';
353 :     $AdaboostValues{'Mycobacterium tuberculosis'}{streptomycin}{SOURCES} = 'TB-ARC initiative, Broad Institute (broadinstitute.org); PMID: 25599400';
354 :     $AdaboostValues{'Mycobacterium tuberculosis'}{streptomycin}{FUNCTION} = 'Streptomycin resistance predicted region';
355 :    
356 :     #-------------------------------------------------------------
357 :    
358 :    

MCS Webmaster
ViewVC Help
Powered by ViewVC 1.0.3