[Bio] / FigKernelPackages / 5S_rRNA_reps.pm Repository:
ViewVC logotype

Annotation of /FigKernelPackages/5S_rRNA_reps.pm

Parent Directory Parent Directory | Revision Log Revision Log


Revision 1.2 - (view) (download) (as text)

1 : golsen 1.1 #
2 :     # 5S_rRNA_reps
3 :     #
4 :     package RNA_reps;
5 :     use strict;
6 :     use gjoseqlib;
7 :    
8 :     our @RNA_reps = read_fasta( \*DATA );
9 :     our $assignment = '5S rRNA ## 5S ribosomal RNA';
10 :     our $tag = '5S_rRNA';
11 :     our $max_expect = 1e-10;
12 :     our $max_exptrapolate = 10;
13 :     our $min_coverage = 0.70;
14 :     our $min_identity = 0.50;
15 :    
16 :    
17 :     __DATA__
18 :     >217.1:must36b10.q2kA37_79628_79747 Helicobacter mustelae 43772 5S rRNA
19 :     TTCCTTGTGTCTATAGAGAGAAGGAAACACCCAGCTCCATTCCGAACCTGGCAGTTAAGC
20 :     TTCTCTTCGCTGATGATACTGCACCTTTCAGGTGTGGGAACGTAGGTCGATGCAGGGTTA
21 :     >235.1:Contig0323_176_296 Brucella abortus 5S rRNA
22 :     CGACCTGGTGGTTATGGCGGAGCGGCTGCACCCGATCCCATTCCGAACTCGGCCGTGAAA
23 :     CGCTCCAGCGCCAATGGTACTTCGTCTCAAGACGCGGGAGAGTAGGTCGCTGCCAGGTCT
24 :     G
25 :     >263.2:Francisella_tularensis_Holarctica_strain_LVS_129447_129563 Francisella tularensis (Livermore) 5S rRNA
26 :     TTTTGGCGATGATAGCTTGTAGGAACCACCTGATCCCATTCCGAACTCAGAAGTGAAACT
27 :     ACAAAACGCCGATGATAGTCTGGCATTGCCCAGGTGAAAGTAGGTAATTGCCATCTT
28 :     >263.2:Francisella_tularensis_Holarctica_strain_LVS_450182_450298 Francisella tularensis (Livermore) 5S rRNA
29 :     CATTGACGATGATAGCAGTCTGGAACCACCTGATCCCATTCCGAACTCAGAAGTGAAACG
30 :     GTCTCACGCCAATGATAGTCTGGCACTGCCCAGGTGAAAGTAGGTAATCGTCAAACC
31 :     >354.1:NZ_AAAU02000010_132184_132064 Azotobacter vinelandii 5S rRNA
32 :     TTGCTTGACGATCATAGAGCGTTGGAACCACCTGATCCCATCCCGAACTCAGCAGTGAAA
33 :     CGACGCATCGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGTCATCGTCAAGCG
34 :     C
35 :     >486.1:lact216g03.p1k_28752_28869 Neisseria lactamica ST-640 5S rRNA
36 :     AGTTTGGCGGCCATAGCGAGTTGGTCCCACGCCTTCCCATCCCGAACAGGACCGTGAAAC
37 :     GACTCAGCGCCGATGATAGTGTGGTTCTCCCATGCGAAAGTAGGTCACTGCCAAACAC
38 :     >521.1:Bav015d01.p2kA7_922_1038 Bordetella avium 5S rRNA
39 :     ACGCCTGACGACCATAGCAAGGTGGCCCCACTCCTTCCCATCCCGAACAGGACAGTGAAA
40 :     CGCCTTCGCGCCGATGATAGTTGGTTTACGCCTGTGAAAGTAGGTCATCGTCAGGCT
41 :     >584.1:mira251d08.p1k_3620_3499 Proteus mirabilis HI4320 5S rRNA
42 :     TTGCTTAGCGGCCATAGCGCGGTGGTCCCACCTGATCCCATGCCGAACTCAGAAGTGAAA
43 :     CGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGGAACTGCTAAGCA
44 :     TT
45 :     >594.1:gall372c09.p1k_10463_10343 Salmonella enterica subsp. enterica serovar Gallinarum 5S rRNA
46 :     TTGTCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAA
47 :     CGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGACA
48 :     T
49 :     >783.1:NZ_AADJ01000001_289108_289227 Rickettsia rickettsii 5S rRNA
50 :     TAGCTTGGTGGTTATAGCATGAGTGAAACACACGATCCCATCCCGAACTCGAATGTGAAA
51 :     CCTCATAGCGCTAATGGTACTATGTCATAAGGCATGGGAGAGTAAGTCGCTGCCAAGCTT
52 :     >817.1:Bf638R-448a02.p1k_24036_24148 Bacteroides fragilis 638R 5S rRNA
53 :     TCAGGTGACTATAGCATCAGGGTTCCACCTCTTCCCATTCCGAACAGAGAAGTTAAGCCT
54 :     GATCACGCCGATGGTACTGCGTAACAGTGGGAGAGTAGGTAGTCGCCGTTTTT
55 :     >817.2:Contig0092_137456_137565 Bacteroides fragilis NCTC9343 5S rRNA
56 :     GTAAGTGATTATAGCACAAGGGTTCCACCTCTTCCCATTCCGAACAGAGAAGTTAAGCCT
57 :     TGTCACGCCGATGGTACTGCATAATAGTGGGAGAGTAGGTAGTCGCCAGC
58 :     >882.1:NC_002937_110870_110985 Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough 5S rRNA
59 :     CCTGGCGTCCATGGAGGAGGGGGTACACCCGATCCCATTCCGAACTCGGAAGTTAAGCCC
60 :     TCCATCGCCGATGATACTGCGGGGTAGCTCGTGGGAAAGTAGGCCGACGCCAGGAC
61 :     >891.1:Contig3_532_648 Desulfuromonas acetoxidans 5S rRNA
62 :     GTCTGGTGGCGATAGCCAAGTGGTCACACCCGTTCCCATGCCGAACACGGAAGTTAAGCA
63 :     CTTGAACGCCGAAAGTAGTTGGGGGCTTCCCCCTGTGAGGATAGGACGCTGCCAGGC
64 :     >891.1:Contig321_32628_32512 Desulfuromonas acetoxidans 5S rRNA
65 :     TTCGGTGGCTATAGCACAGAGGTCACACCTGTTCCCATCTCGAACACAGAAGTTAAGCTC
66 :     TGTTGCGCCGATGATACTGCATGGGCAACTATGTGGGAAAGTAGGTCGCCGCCGAAT
67 :     >891.1:Contig324_21881_21764 Desulfuromonas acetoxidans 5S rRNA
68 :     TTTCGGTGGCTATAGCGCAGGAGTCACACCTGTTCCCATCCCGAACACAGAAGTTAAGCC
69 :     CTGCCGCGCCGATGATACTGCACGGGTGACTGTGTGGGAAAGTAGGTCGCCGCCGAAA
70 :     >985.1:NZ_AABD03000002_619_732 Cytophaga hutchinsonii 5S rRNA
71 :     TAATGGTGGCTATAGCGTTGGTGTTCACCTCTTCCCATTTCGAACAGAGAAGTTAAGCCC
72 :     AACTGCGCCAATGGTACTGCAGTCAAATGTGGGAGAGTAGGTCGCTGCCAACTT
73 :     >1085.1:NZ_AAAG02000001_1070120_1069999 Rhodospirillum rubrum 5S rRNA
74 :     TGGCCTGGTGGTCATTGCGGGCTCGAAACACCCGATCCCATCCCGAACTCGGCCGTGAAA
75 :     GAGCCCTGCGCCAATGGTACTGCGTCTTAAGGCGTGGGAGAGTAGGTCGCCGCCAGGCCT
76 :     TC
77 :     >1140.3:NC_007604_573571_573690 Synechococcus elongatus PCC 7942 5S rRNA
78 :     TCCTGGTGTCTATGGCGGTATGGAACCACTCTGACCCCATCCCGAACTCAGTTGTGAAAC
79 :     ATACCTGCGGCAACGATAGCTCCCGGGTAGCCGGTCGCTAAAATAGCTCGACGCCAGGTC
80 :     >1148.1:NC_000911_2448767_2448646 Synechocystis sp. PCC 6803 5S rRNA
81 :     TTCTTGGTGTCTTTAGCGTCATGGAACCACTCCGATCCCATCCCGCACTCGGTTGTGAAA
82 :     TGTGACAGCGGCGACGATACTCTGGGGGTTGCCCCACGGCACAATAGTCCGATGCCAAGT
83 :     TC
84 :     >1255.1:scaffold_15_422_538 Pediococcus pentosaceus 5S rRNA
85 :     TGTGGTGACGATAGTGAGAAGGATATACCTGTTCCCATGTCGAACACAGAAGTCAAGCTT
86 :     CTTAACGCCGAGAGTAGTTGGGGGATCGCCCCCTGCGAGGGTAGGACGTTGCCATGC
87 :     >1314.1:Contig0001_1789_1906 Streptococcus pyogenes M5 5S rRNA
88 :     AGTTAAGTGACGATAGCCTAGGAGATACACCTGTACCCATGCCGAACACAGCAGTTAAGC
89 :     CCTAGAACGCCTGATGTAGTTGGGGGTTGCCCCCTGTGAGATAAGGTAGTCGCTTAGC
90 :     >1491.1:Contig0003_534_650 Clostridium botulinum ATCC 3502 5S rRNA
91 :     TCTGGTGATTATGGCTTGAAGGTAACACCCGTTTCCATGCCGAACACGAAGGTTAAGCTT
92 :     CAAAGCGCTGATGGTACTGCAGGGGAAGCCCTGTGGAAGAGTAGGTCGTTGCCAGAT
93 :     >1496.1:CDCP114a04.p2cc9_53855_53736 Clostridium difficile 630 5S rRNA
94 :     TATGTGGTTATAATAGCAAAGAGGATACACCTGTTCCCATTCCGAACACAGAAGTTAAGC
95 :     TCTTTAGCGCTGATGGTACTTGGTGGGAAACTGCCTGGGAGAGTAGGACGTAGCCACGTG
96 :     >1596.1:NZ_AAAO02000003_69606_69722 Lactobacillus gasseri 5S rRNA
97 :     TACGGTGGCGATGGCAAGAAGGATACACCTGTTCCCATGCCGAACACAGAAGTTAAGCTT
98 :     CTTAACGCCGAGAGTAGTTGGTGGGAAACTGCCTGCGAGGGTAGGCAGTCGCCGTGC
99 :     >1806.1:micro376a11.q1k_13360_13245 Mycobacterium microti OV254 5S rRNA
100 :     GTTACGGCGGCCACAGCGGCAGGGAAACGCCCGGTCCCATTCCGAACCCGGAAGCTAAGC
101 :     CTGCCAGCGCCGATGATACTGCCCCTCCGGGTGGAAAAGTAGGACACCGCCGAACA
102 :     >31964.1:clav-201h02.q1ka_18957_18836 Clavibacter michiganensis 5S rRNA
103 :     GTTTCGGCGGCCATAGCGAGAGGGAAACGCCCGGTAACATTCCGAACCCGGAAGCTAAGA
104 :     CTCTCAGCGCCGATGGTACTGCAGGGGGGACCCTGTGGGAGAGTAGGACACCGCCGGACT
105 :     TA
106 :     >36870.1:NC_004344_141380_141499 Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis 5S rRNA
107 :     TTCCTGACAATATTATCGCGATAGAACCACCTGAATCCATACCGAACTCAGAAGTGAAAT
108 :     GTCGTAGTTCCGATGGTAGTGTGAGGTTTCCTTATGTGAGAGTAGGAGATTGTCAGGAAA
109 :     >36873.1:2351477_fasta.screen.Contig683_352_469 Burkholderia xenovorans LB400 5S rRNA
110 :     ATGCCTGATGATCATAGCGAGTCGGTCCCACCCCTTCCCATCCCGAACAGGACCGTGAAA
111 :     CGACTCCACGCCGATGATAGTGCGGATTACCCGTGTGAAAGTAGGTCATCGTCAGGCT
112 :     >39765.1:3634493_Cont40_33724_33842 Thiomicrospira crunogena XCL-2 5S rRNA
113 :     TGCTTGGGGACAATAGCAAGATGGAACCACCTGATCCCTTTCCGAACTCAGAAGTGAAAC
114 :     GTCTTAGCGCCGATGGTAGTGTGTCAGGTGGCATGTGAGAGTAGGTCATCCCCAAGCTT
115 :     >40324.1:malt282b03.p1k_622_740 Stenotrophomonas maltophilia K279a 5S rRNA
116 :     TCCCTGGTGAAATTAGCGCTGTGGAACCACCCGATCCCATCCCGAACTCGGAAGTGAAAC
117 :     GCAGCTGCGCCGATGGTAGTGTGGCTCAAGCCATGCGAGAGTAGGTCATCGCCAGGGTT
118 :     >48935.1:NZ_AAAV01000115_1018_899 Novosphingobium aromaticivorans 5S rRNA
119 :     TTGCCTGGTGGCCATAGCGTCCGTGCCCCACCCGATCCCATCTCGAACTCGGCCGTGAAA
120 :     CCGGACAGCGCCAATGGTACTAACGCTCAAGCGTTGGAAGAGTAGGTCGTCGCCAGGCAT
121 :     >52598.3:SulfEE36.contigs_4_5975_6093 Sulfitobacter sp. EE-36 5S rRNA
122 :     GGTTTGGTGGTCATAGCGTAAGCAAAACACCCGATCCCATCCCGAACTCGGCAGTTAAGT
123 :     GCTACTGCGCCAATGGTACTGCGTCTTAAGACGTGGGAGAGTAGGTCACCGCCAAACCT
124 :     >59919.1:NC_005072_318012_318131 Prochlorococcus marinus subsp. pastoris str. CCMP1986 5S rRNA
125 :     ATCCTGGTGTTCATGGCGATGTGGAACCACTCCGATCCATCTCGAACTCGGTTGTGAAAC
126 :     GCATCAGCGGCGAAAATATTTAGGGGGTAGCCCCTTGAGAAAATAGCTCAATGCCAGGTA
127 :     >62977.3:NC_005966_23620_23738 Acinetobacter sp. ADP1 5S rRNA
128 :     TTTGCTGGCGACAATAGCAAGAGTGAACCACCTGATCCCTTCCCGAACTCAGAAGTGAAA
129 :     CCTCTTCGCGCTGATGGTAGTGTGGCGTTAGCCATGTGAGAGTAAGTCATCGCCAGCTT
130 :     >63737.1:NZ_AAAY02000002_75043_74923 Nostoc punctiforme PCC 73102 5S rRNA
131 :     TTCCTGGTGTCTATTGCGCGGTGGAACCACACTGAACCCTTCCCGAACTCAGAGGTGAAA
132 :     CGCTGTTGCGGCAACGATAGTTTAGGGGTCGCCCTACGCAAAAATAGCTCGGTGCCAGGT
133 :     A
134 :     >66692.3:NC_006582_16729_16851 Bacillus clausii KSM-K16 5S rRNA
135 :     AGAGTCCGGTGACAATGGCAAAGAGGTCACACCCGTTCCCATGCCGAACACGGCCGTTAA
136 :     GCTCTTTTGCGCCGATGGTAGTTGGAGGCTTCCTCCTGTGAGAGTAGGACGTTGCCGGGC
137 :     AAA
138 :     >66692.3:NC_006582_263223_263342 Bacillus clausii KSM-K16 5S rRNA
139 :     TAAGTTCGGTGGCAATGGCAAAGAGGTCACACCCGTTCCCATGCCGAACACGGTCGTTAA
140 :     GCTCTTTTGCGTCGATGGTAGTTAGGGGCTTCCCCTTGCGAGAGTAGAACGCTGCCGGAC
141 :     >68909.1:3634504_Cont108_51084_51204 Deinococcus geothermalis DSM11300 5S rRNA
142 :     ACCCCCGTGCCTTGAGCGCCGTGGAACCACCCCATCCCATGCCGAACTGGGTCGTGAAAC
143 :     GCGGCAGCGCCTATGCTACTCGGACCGCAGGGTCCCGGAAAAGTCGGTCAGCGCGGGGGT
144 :     T
145 :     >71421.1:NC_000907_123555_123437 Haemophilus influenzae Rd KW20 5S rRNA
146 :     ATCCTGGCGGCGATAGTGCGGTGGACCCACCTGAGACCATACCGAACTCAGAAGTGAAAC
147 :     GCTGTAATGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGGCACCGCCAGGTT
148 :     >71421.1:NC_000907_629394_629511 Haemophilus influenzae Rd KW20 5S rRNA
149 :     TTTTGGCAGAGATAGTGCAATAGATCCACCTGAGACCATACCGAACTCAGAAGTGAAATG
150 :     TTGTAACGCTGATGGTAGTGTGGGGGTTCCCCATGTGAGAGTAAGGCACTGCCAATCG
151 :     >76114.4:NC_006513_545404_545289 Azoarcus sp. EbN1 5S rRNA
152 :     AGTCTGACGACCATAGCGTCCTGGCACCACCCCTTCCCATCCCGAACAGGACCGTGAAAC
153 :     AGGACCGCGCCGATGATAGTGCCTAAACGGGTGCGAAAGTAGGTCATCGTCAGACT
154 :     >83555.1:cab-33g11.p2k1028_268044_267925 Chlamydophila abortus 5S rRNA
155 :     TTTGCTTGGTGATAATGGAAAAAGGGATACACCTGATACCATTCCGAACTCAGAAGTTAA
156 :     GCCTTTTATCGCCGATGGTACTATACACAAGAGTATGGGAGAGTAGGTCGTCGCCAAGCT
157 :     >85962.1:NC_000915_448458_448577 Helicobacter pylori 26695 5S rRNA
158 :     TCCTTGTGCCTTTAGAGAAGAGGAACTACCCAGTTAACCATTCCGAACCTGGAAGTCAAG
159 :     CTCTTCATCGCTGATAATACTGCTCTTTTCAAGAGTGGGAATGTAGGTCGGTGCAGGGAT
160 :     >89187.3:RnubISM.contigs_3_1545612_1545730 Roseovarius nubinhibens ISM 5S rRNA
161 :     GGTTTGGTGGTCATAGCACAAGCGAAACACCCGGTCCCATCCCGAACCCGGCCGTTAAGC
162 :     GCTGTCGCGCCGATGGTACTGCGACTTAAGTCGTGGGAGAGTAGGTCACCGCCAAACCT
163 :     >93062.4:NC_002951_534059_534174 Staphylococcus aureus subsp. aureus COL 5S rRNA
164 :     GTCTGGTGACTATAGCAAGGAGGTCACACCTGTTCCCATGCCGAACACAGAAGTTAAGCT
165 :     CCTTAGCGTCGATGGTAGTCGAACTTACGTTCCGCTAGAGTAGAACGTTGCCAGGC
166 :     >100226.1:NC_003888_1468710_1468589 Streptomyces coelicolor A3(2) 5S rRNA
167 :     GTTTCGGTGGTCATAGCGTAGGGGAAACGCCCGGTTACATTTCGAACCCGGAAGCTAAGC
168 :     CTTACAGCGCCGATGGTACTGCAGGGGGGACCCTGTGGGAGAGTAGGACGCCGCCGAACT
169 :     CC
170 :     >103690.1:NC_003272_2382092_2382212 Nostoc sp. PCC 7120 5S rRNA
171 :     TTCCTGGTGCCTATGGTGCAGTGGTACCACTCTGACCCCATCCCGAACTCAGAGGTGAAA
172 :     CGCTGCTATGGCTACGATAGTCTAGGGGTTGCCCTATGCCACAATCGCTCGGTGCCAGGT
173 :     T
174 :     >107806.1:NC_002528_539430_539310 Buchnera aphidicola str. APS (Acyrthosiphon pisum) 5S rRNA
175 :     TTCCTGGTAAAAATAGTGTAGTGGTACCACCTGAATCCATTCCGAACTCAGAAGTGAAAC
176 :     GCTATAACGCCGATGGTAGTACGGGGCCTCCCCGTGTGAGAGTAGGTCAAATCCAGGAAA
177 :     A
178 :     >115711.1:NC_002179_1066053_1065934 Chlamydophila pneumoniae AR39 5S rRNA
179 :     TTAGCTTGGCGATACTGGAGAAAGGGATACACCTGATACCATTCCGAACTCAGAAGTTAA
180 :     GCCTTTTATCGCTGATGGTACTATACACAAGAGTATGGGAGAGTAAGTCGTTGCCAAGCT
181 :     >155920.1:NZ_AAAM01000002_5148_5264 Xylella fastidiosa Ann-1 5S rRNA
182 :     TCCCTGGTGATATTAGCGCTGTGGAACCACCCGATCCCATCCCGAACTCGGAAGTGAAAC
183 :     GCAGCTGCGCCGATGGTAGTGTGGGTCTCCCATGCGAGAGTAGGTCATTGCCAGGGT
184 :     >156405.1:Contig11_1121_1010 uncultured Chlorobi bacterium 5S rRNA
185 :     TTACGGCGACTATGTCTCAGGTGATCACCTCTTCCCATTCCGAACAGAGTCGTTAAGCCC
186 :     TGATGAGCCGATGGTACTGCTTAACTGCGGGAGAGTAGGTCGTCGCCGAATT
187 :     >156889.1:NZ_AAAN02000020_62909_62792 Magnetococcus sp. MC-1 5S rRNA
188 :     TTTCCGGTAGAGATAGCGAGGGAGTCACACCCGATCCCATCCCGAACTCGGAAGTTAAGC
189 :     CCCTTAGCGCCGATGATACTGCGTCTTAAGACGTGGGAAAGTAGGACACCGCCGGAAA
190 :     >159087.4:NC_007298_81794_81910 Dechloromonas aromatica RCB 5S rRNA
191 :     CGTCTGGCGTCAATAGCCTGCTGGTACCACCCCTTCCCTTCCCGAACAGGACCGTGAAAC
192 :     AGCATCGCGCCAATGATAGTGAGCTTACCGCTCGCGAAAGTAGGTCAACGCCAGACT
193 :     >167879.3:NC_003910_40129_40248 Colwellia psychrerythraea 34H 5S rRNA
194 :     TTGTTTAGCGACAATAGCGCTGTGGTCCCACCTGATCCCTTTCCGAACTCAGAAGTGAAA
195 :     CGCAGTTGCGCCGATGGTAGTGTGGGAGTTCCCATGTGAGAGTAGGACATTGCTAAACTT
196 :     >169963.1:NC_003210_242273_242389 Listeria monocytogenes EGD-e 5S rRNA
197 :     GTCTGGTAGTTATGGCGAGAAGGTCACACCCGTTCCCATCCCGAACACGGTAGTTAAGCT
198 :     TCTCTGCGCCAATGGTAGTTGGGGGCTTCCCCCTGCGAGAGTAGGTCGCTGCCGGGC
199 :     >176280.1:NC_004461_1594564_1594446 Staphylococcus epidermidis ATCC 12228 5S rRNA
200 :     GTCTGGTGACAATGGCAAGGAGGTCACACCTGTTCCCATGCCGAACACAGAAGTTAAGCT
201 :     CCTTAGCGCCGATGGTAGTCGGACTGACGTTCCGCTAGAGTAGGACGTTGCCAGGCAAA
202 :     >177439.1:NC_006138_811337_811458 Desulfotalea psychrophila LSv54 5S rRNA
203 :     TTTTCGGTGGCCATAGCGAAGAGGCTCCACCCGTTCCCATTCCGAACACGGAAGTTAAGC
204 :     TCTTCAGCGCCGATGGTACTGCATGGGAGACTGTGTGGGAGAGTAGGTCGCCGCCGAATT
205 :     TT
206 :     >189518.1:NC_004342_184083_184203 Leptospira interrogans serovar Lai str. 56601 5S rRNA
207 :     TTCCCGGTGACTATAGAGAGAGGGCCACACCCGTTCCCATCCCGAACACGGAAGTTAAGC
208 :     CTCTCATCGCTGATGGTACTATGTGGTTCGCTGCATGGGAGAGTAGGACGTTGCCGGGTT
209 :     T
210 :     >190304.1:NC_003454_448364_448246 Fusobacterium nucleatum subsp. nucleatum ATCC 25586 5S rRNA
211 :     GCTTGGTGAGTATAGCTATGGGGGTACACCTAGTTACATTCCGAACCTAGAAGTTAAGCC
212 :     CATATACGCTGATGGTACTTGGCTGGAAGCGGCCTGGGAGAGTATGGATTTGCCAAGCA
213 :     >190650.1:NC_002696_2836576_2836455 Caulobacter crescentus CB15 5S rRNA
214 :     TGACCTGGTGGCTATGCCGGGGGTTCCCCACCCGATCCCATTCCGAACTCGGTCGTTAAG
215 :     TCCCCCTGGGCCAATGGTACTTCGTCTCAAGGCGCGGGAGAGTAGGTCGCCGCCAGGTCC
216 :     GC
217 :     >192222.1:NC_002163_44741_44860 Campylobacter jejuni subsp. jejuni NCTC 11168 5S rRNA
218 :     ATGTCCGTGATTATACAGATGTGGAAACGCCTTGCTCCATCCCGAACCAAGAAGCTAAGC
219 :     ACATCGTGGGTGATGATACTACGCCTTACTGGCAGGGGGAAAGTAGCTCATTGCGGACTT
220 :     >194439.1:NC_002932_144489_144600 Chlorobium tepidum TLS 5S rRNA
221 :     TTACGGCGACTATATCCCTGGTGTTCACCTCTTCCCATTCCGAACAGAGTCGTTAAGCCC
222 :     AGGAGAGCCGATGGTACTGCTTTATTGCGGGAGAGTAGGTCGTCGCCGAGTT
223 :     >195102.1:NC_003366_14868_14986 Clostridium perfringens str. 13 5S rRNA
224 :     TCTGGTGATGATGCTCTTTAGGGTAACACCCGTTTTCCATTCCGAACACGAAGGTTAAGC
225 :     CTATTGAGGCCGATGGTACTGCACGGGAGACTGTGTGGGAGAGTAGGTGGTTGCCAGGT
226 :     >195102.1:NC_003366_100909_101026 Clostridium perfringens str. 13 5S rRNA
227 :     TCTGGTGATGATGTTCTTTAGGGTAACACCCGTTCCCATTCCGAACACGACGGTTAAGCC
228 :     TTTAGAAGCCGATGGTACTGCACGGGAGACTGTGTGGGAGAGTAGGTGGTCGCCAGGT
229 :     >195102.1:NC_003366_2806531_2806414 Clostridium perfringens str. 13 5S rRNA
230 :     TCTAGTGATGATGCGTTTAAGGGTAACACCCGTTCCCATTCCGAACACGACGGTTAAGCC
231 :     TTTAACGGTCGATGGTACTGCACGGGAGACTGTGTGGGAGAGTAGATGGTCGCTAGGT
232 :     >196164.1:NC_004369_936756_936876 Corynebacterium efficiens YS-314 5S rRNA
233 :     TGTGTCGGTGGTGATAGTAGCAGGGAAACGCCCGGTCCCATTCCGAACCCGGAAGCTAAG
234 :     CCTGGTTACGCTGATGGTACTGCACTCGGGAGGGTGTGGGAGAGTAGGTGACCGCCGACC
235 :     A
236 :     >196600.1:NC_005140_310829_310950 Vibrio vulnificus YJ016 5S rRNA
237 :     TTGCTTGGCGACCATAGCGTTTTGGACCCACCTGAATCCATTCCGAACTCAGAAGTGAAA
238 :     CGAAATAGCGTCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGAACATCGCCAGGCT
239 :     TA
240 :     >196600.1:NC_005139_2943255_2943134 Vibrio vulnificus YJ016 5S rRNA
241 :     TTGCTTAGCGACCATAGCGCTTTGGACCCACCTGATTCCATTCCGAACTCAGAAGTGAAA
242 :     CGAAGTAGCGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGACATTGCTAGGCT
243 :     CT
244 :     >197221.1:NC_004113_2331083_2330964 Thermosynechococcus elongatus BP-1 5S rRNA
245 :     TGCCTAGTGCCTATAGCGCGGCGGAACCACGCTGATCCATCCCGAACTCAGAGGTGAAAC
246 :     GTCGCAGCGGTGAAGATAGTAGGAGGGTCGCCTCCTGCAAAAATAGCTCGGTGCTAGGCA
247 :     >198094.1:NC_003997_14201_14321 Bacillus anthracis str. Ames 5S rRNA
248 :     AGTTTGGTGATGATGGCAGAGAGGTCACACCCGTTCCCATACCGAACACGGAAGTTAAGC
249 :     TCTCTAGCGCCGATGGTAGTTGGGACCTTGTCCCTGTGAGAGTAGGACGTCGCCAAGCAA
250 :     C
251 :     >198804.1:NC_004061_540257_540137 Buchnera aphidicola str. Sg (Schizaphis graminum) 5S rRNA
252 :     TGCCTGGTAAAAATAGTGTAGTGGTACCACCTGAATCCATTCCGAACTCAGAAGTGAAAC
253 :     GCTACAACGCCAATGGTAGTACGGGGTCTCCCCGTGTGAGAGTAGGTATCAGCCAGGCAA
254 :     A
255 :     >203119.1:NZ_AABG03000017_55701_55581 Clostridium thermocellum ATCC 27405 5S rRNA
256 :     ATTCTGGTGGCAATAACGAGAAGGAAACACCCGTTCCCATTCCGAACACGGTAGTTAAGC
257 :     TTCTCAGTGCCGATGATACTAGGATGGAGACGTCCTGGGAAAGTAGGTCGCTGCCAGATT
258 :     T
259 :     >203120.1:NZ_AABH02000008_53009_52893 Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 5S rRNA
260 :     TGTCGTGTCGATAGCATAGAGGACACACCTGTTCCCATACCGAACACAGAAGTTAAGCTC
261 :     TATAGCGCCGAAAGTAGTTGGAGGATCGCTTCCTGCGAGGATAGGACGATGCGGTGC
262 :     >203122.1:NZ_AABI03000002_881751_881632 Microbulbifer degradans 2-40 5S rRNA
263 :     TTGCCTGACGACAATAGAGCATTGGAACCACCTGATCCCATCCCGAACTCAGCAGTGAAA
264 :     CGATGCATCGCCGATGGTAGTGTGGGGGTTCCCATGTGAGAGTAGGTCATCGTCAGGCTT
265 :     >203123.1:NZ_AABJ03000008_6992_6876 Oenococcus oeni PSU-1 5S rRNA
266 :     TGTCGTGTTAATTCCGATGAGGCCACACCTGTTCCCATTCCGAACACAGAAGTTAAGCTT
267 :     GTCAGGGCCCAAAGTAGTTACAGGAACGCCTGTTGCAAGGTTAGGTCGATGCGATGC
268 :     >203124.1:NZ_AABK03000001_1039402_1039522 Trichodesmium erythraeum IMS101 5S rRNA
269 :     TTCCTGGTGTCTATGACGCAGTGGAACCACTCCGATCCATCTCGAACTCGGAAGTGAAAC
270 :     GCTGCAGTGGTGAAGATACTCGGTGGGTAGCTGCCCGGTAAAATAGCACGATGCCAGGTT
271 :     A
272 :     >203267.1:NC_004572_218447_218566 Tropheryma whipplei str. Twist 5S rRNA
273 :     GTCTCGGGGGCAATGGCAAGAGGGAAACGCCTGGTTACATTCCGAACCCAGAAGCTAAGC
274 :     CTCTTAGCGCTGATGGTACTGCAGGGGGGACCCTGTGGGAGAGTAAGACGCCCCCGGGCT
275 :     >203907.1:NC_005061_238665_238785 Candidatus Blochmannia floridanus 5S rRNA
276 :     AACTTGGTGGCATTAGCGCGATAGTACCACCTGATGACCATTCCGAACTCAGAAGTGAAA
277 :     TGTCGTGGTACCGATGGTAGTGTGAGGATTCCTCATGTGAGAGTAGGGGGCTGCCAAGTT
278 :     T
279 :     >205913.1:NZ_AABM02000003_150365_150246 Bifidobacterium longum DJO10A 5S rRNA
280 :     TTTGCGGCGGCCATGGCCCAGGTGAGACGCCCGGTCCCATTCCGAACCCGGAAGCTAAGG
281 :     CCTGGCACGGCGATGGTACTGCACCCGACAGGGTGTGGGAGAGTAGCACGCCGCCGCACC
282 :     >205914.1:NZ_AABO02000003_130956_130838 Haemophilus somnus 129PT 5S rRNA
283 :     AGCTTGGCGGCGATAGTGCGGTGGGACCACCTGACACCATGCCGAACTCAGAAGTGAAAC
284 :     GCTGTAACGCCGATGGTAGTGTGGGGATTCCCCATGTGAGAGTAGGGCACCGCCAAGTT
285 :     >205914.1:NZ_AABO02000007_12502_12386 Haemophilus somnus 129PT 5S rRNA
286 :     TTTTGGCAGTCATAGTGCAATGGAACCACCTAACTCCTTGCCGAACTTAGAAGTGAAACG
287 :     TTGTTACGCCGATGGTAGTGTGGGGATTCCCCATGTGAGAGTAGGTCACTGCCAAAT
288 :     >205921.3:NC_007432_21204_21321 Streptococcus agalactiae A909 5S rRNA
289 :     AGTTAAGTGATAATTGCCTAGGAGATACACCTGTTCTCATGCCGAACACAGAAGTTAAGC
290 :     CCTAGAACGCCGGAAGTAGTTGGGGGTTGCCCCCTGTGAGATAAGGTAGTCGCTTAGC
291 :     >207559.3:NC_007519_74882_74997 Desulfovibrio desulfuricans G20 5S rRNA
292 :     CTTGGTGACCATGGAGGCTGGGGTACACCCGATCCCATTCCGAACTCGGAAGTTAAGCCA
293 :     GCCATCGCCGATGATACTGCAAGGGAGCTTGTGGGAAAGTAGGCCGTCGCCAAGGC
294 :     >210007.1:NC_004350_21896_22013 Streptococcus mutans UA159 5S rRNA
295 :     TGTTAAGTGATGATAGCCTAGGGGAGACACCTGTATCCATGCCGAACACAGCAGTTAAGC
296 :     CCTAGCACGCCTGAAGTAGTTGGGGGTTGCCCCCTGTGAGATAGGGTCGTCGCTTAGC
297 :     >211586.1:NC_004347_51056_51176 Shewanella oneidensis MR-1 5S rRNA
298 :     TTGCTTGGTGACAATAGCATTGTGGTCCCACCTGATCCCATCCCGAACTCAGAAGTGAAA
299 :     CGCAATCGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGTCATCGCCAAGCG
300 :     C
301 :     >212717.1:NC_004557_5447_5331 Clostridium tetani E88 5S rRNA
302 :     TCTGGTGATTATAGCTAGAAGGTAACACCCGTTCCCATGCCGAACACGATGGTTAAGCTT
303 :     CTAAGCGCCGATGGTACTGCAAGGGTGACCTTGTGGGAGAGTAGGACGTTGCCAGGT
304 :     >216432.3:CatlHTCC2559.contigs_4_1261713_1261822 Croceibacter atlanticus HTCC2559 5S rRNA
305 :     CGAGGTGGCTGTGGCGGCGGGGCGCACCCCTTCCCATCCCGAACAGGACGGTTAAGCCCG
306 :     CCAGCGCCGATGGTACTGCTATCCAGTGGGAGAGTAGGTCGCCGCCTTTC
307 :     >216596.1:rhiz582d11.q1n_69432_69552 Rhizobium leguminosarum bv. viciae 3841 5S rRNA
308 :     CGACCTGGTGGTTATGGCGGGGTGGCTGCACCCGTTCCCTTTCCGAACACGGCCGTGAAA
309 :     CGCCCCTGCGCCCATGGTACTTCGTCTTAAGACGCGGGAGAGTAGGTCGCTGCCAGGTCT
310 :     G
311 :     >220668.1:NC_004567_507858_507974 Lactobacillus plantarum WCFS1 5S rRNA
312 :     TGTGGTGACGATGGCGAGAAGGATACACCTGTTCCCATGTCGAACACAGAAGTTAAGCTT
313 :     CTTAGCGCCGAGAGTAGTTGGGGGATCGCTCCCTGCGAGGGTAGGACGTTGCCATGC
314 :     >221109.1:NC_004193_108306_108425 Oceanobacillus iheyensis HTE831 5S rRNA
315 :     AGTCTGGTAGCGATAGCGAAGAGGCCACACCTGTTCCCATGCCGAACACAGAAGTTAAGC
316 :     TCTTCAGCGCCGATGGTAGTTGGGGCTTTGCCCCTGCAAGAGTAGGACGCCGCCAGGCAA
317 :     >221109.1:NC_004193_679268_679386 Oceanobacillus iheyensis HTE831 5S rRNA
318 :     GTCTGGTAGCGATAGCGAGAAGGTCACACCTGTTCCCATGCCGAACACAGAAGTTAAGCT
319 :     TTTCAGCGCCAATGGTAGTTGGGGTTTTACCCCTGCAAGAGTAGGACGCCGCCAGGCAA
320 :     >221988.1:NC_006300_3318_3436 Mannheimia succiniciproducens MBEL55E 5S rRNA
321 :     ATCCTGGCGGCGATAGTGCAGTGGTCCCACCTGAATCCATGCCGAACTCAGAAGTGAAAC
322 :     GCTGTTATGCCGATGGTAGTGTGGGGTATCCCCATGTGAGAGTAGGTCACCGCCAGGTT
323 :     >221988.1:NC_006300_407092_407209 Mannheimia succiniciproducens MBEL55E 5S rRNA
324 :     TTTTGGCAGCGATAGTGCAGTGGACCCACCTAATTCCATGCCGAACTTAGAAGTGAAACG
325 :     CTGTTACGCCGATGGTAGTGTGGGGCTTCCCCATGTGAGAGTAGGTCACTGCCAATTT
326 :     >223926.1:NC_004603_2775885_2775763 Vibrio parahaemolyticus RIMD 2210633 5S rRNA
327 :     TTACTTGGCGACCATAGCACTTTGGACCCACCTGACTTCCATTCCGAACTCAGAAGTGAA
328 :     ACGAAGTAGCGTCGATGGTAGTGTGGGGCTTCCCCATGTGAGAGTAGAACATCGCCAGGT
329 :     TCT
330 :     >224308.1:NC_000964_14689_14807 Bacillus subtilis subsp. subtilis str. 168 5S rRNA
331 :     GTTTGGTGGCGATAGCGAAGAGGTCACACCCGTTCCCATACCGAACACGGAAGTTAAGCT
332 :     CTTCAGCGCCGATGGTAGTCGGGGGTTTCCCCCTGTGAGAGTAGGACGCCGCCAAGCAA
333 :     >224308.1:NC_000964_950962_951079 Bacillus subtilis subsp. subtilis str. 168 5S rRNA
334 :     GTCTGGTGATGATGGCGAAGAGGTCACACCCGTTCCCATGCCGAACACGGAAGTTAAGCT
335 :     CTTCAGCGCCGATGGTAGTCGGGGGTTTCCCCCTGTGAGAGTAGGACATCGCCAGGCA
336 :     >224324.1:NC_000918_567889_567769 Aquifex aeolicus VF5 5S rRNA
337 :     CCCCTGGTGGCCATAGCGGGGGGGAAACACCCGGTCCCATTCCGAACCCGGCAGTTAAGC
338 :     CCCCCAGCGCCGATGATACTGTGCCGGCAGCGGCACGGGAAAGTAGGTCGCTGCCAGGGG
339 :     C
340 :     >224911.1:NC_004463_1533503_1533623 Bradyrhizobium japonicum USDA 110 5S rRNA
341 :     CGGCCTGGTGGTTTTAGCGAAGAGCCTCAACCCGATCCCATCCCGAACTCGGCCGTTAAA
342 :     CTCTTCAGCGCCAATGGTACTATGGCTTAAGCCCTGGGAGAGTAGGTCGCTGCCAGGCCT
343 :     G
344 :     >224915.1:NC_004545_508004_507887 Buchnera aphidicola str. Bp (Baizongia pistaciae) 5S rRNA
345 :     CCTGGTAAAAATAGTGTTATGGTACCACCTGAAACCATGCCGAACTCAGAAGTGAAACAT
346 :     TTCAACGCCGATGGTAGTGCAGGGTATCCCTGTGTGAGAGTAGGACATTACCAGGTTT
347 :     >226185.1:NC_004668_253255_253370 Enterococcus faecalis V583 5S rRNA
348 :     TGTGGTGGCGATAGCGAGAAGGATACACCTGTTCCCATGCCGAACACAGAAGTTAAGCTT
349 :     CTTAGCGCCGATTGTAGTGAAGGGTTTCCCTTTGTGAGAGTAGGACGTCGCCACGC
350 :     >226186.1:NC_004663_1626610_1626498 Bacteroides thetaiotaomicron VPI-5482 5S rRNA
351 :     TCAGGTGGTTATAGCACGAGGGTTCCACCTCTTCCCATTCCGAACAGAGAAGTTAAGCCT
352 :     CGTCACGCCGATGGTACTGCGTAACAGTGGGAGAGTAGGTAGCCGCCGTTTTT
353 :     >227377.1:NC_002971_171959_172078 Coxiella burnetii RSA 493 5S rRNA
354 :     TTTCCTGGCGGCCATAGCGAGCGGGCCCCACCTGATTCCATTCCGAACTCAGAAGTGAAA
355 :     ACGCTTAGCGCCGATGATAGTGTGGGTCTCCCATGCGAAAGTAGGTCACCGCCAGGTTTT
356 :     >228399.1:NZ_AACK01000001_104087_103969 Actinobacillus pleuropneumoniae serovar 1 str. 4074 5S rRNA
357 :     ATTCTGGCGACCAGAGTGCTGTGGCTCTACCTGACTCCATTCCGAACTCAGAAGTAAAAC
358 :     GCAGTAACGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGGCATCGCCAGATT
359 :     >228399.1:NZ_AACK01000026_28269_28152 Actinobacillus pleuropneumoniae serovar 1 str. 4074 5S rRNA
360 :     TCCCGACGACAATAGTGCGGTTGTCCCACCTGAATCCATCCCGAACTCAGAAGTGAAAAG
361 :     CCGTTACGTCGATGGTAGTGTGGGGCTTCCCCATGTGAGAGTAGAGCATCGTCGGGTT
362 :     >228410.1:NC_004757_74038_74155 Nitrosomonas europaea ATCC 19718 5S rRNA
363 :     TTGCTTGGCGGCCATAGCGCTTTGGACCCACCTTTTCCCATCCCGAACAGAGAAGTGAAA
364 :     CGAAGCAGCGCCGATGATAGTGTGTTTCCACATGTGAAAGTAGGTCACCGCCAGGCTT
365 :     >233150.3:NC_004829_83491_83598 Mycoplasma gallisepticum R 5S rRNA
366 :     TGTGTGATATCGATATCGTGATGGAAACACCTGGTCCCATTCCGAACCCAGAAGTTAAGC
367 :     ATCATGGAGCCAAAGGTAGCGCAAGCAAGAATAGGAAAATATCACGCA
368 :     >233412.1:NC_002940_15878_15995 Haemophilus ducreyi 35000HP 5S rRNA
369 :     ATTCTGGCGACAACAGTGCAGTGGCACCACCTGAATCCATCCCGAACTCAGAAGTGAAAC
370 :     GCTGTTACGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGTCATCGCCAGAG
371 :     >233412.1:NC_002940_16051_16168 Haemophilus ducreyi 35000HP 5S rRNA
372 :     GATTAACAGCAATAGTGCAGTGGTCCCACCTGAATCCATCGCGAACTCAGAAGTGAAACG
373 :     CTGTTACGCCGATGGTAGTGTGGGGCTTCCCCATGTGAGAGTAGGACACTGTTAATCT
374 :     >234826.3:NC_004842_84032_84150 Anaplasma marginale str. St. Maries 5S rRNA
375 :     TGGCTGGTGGTTATGGCGGGAGTGAAACACCCGGTAACATCCCGAACCCGGAAGTTAAGC
376 :     CTCCCAGCGCCTGTGGTACTTTGTCTTAAGACACGGGAGAGAGGGTCGCTGCCAGCCTT
377 :     >235279.1:NC_004917_953311_953192 Helicobacter hepaticus ATCC 51449 5S rRNA
378 :     TTTTTCTTGTGTTTATAGAGAGAAGGCAACACCCAGCTCCATTCCGAACCTGGCAGTTAA
379 :     GCTTCTCTTCGCCGATGATACTGCATCTTTCAGGTGTGGGAATGTAGGTCGATGCAGGGA
380 :     >235909.3:NC_006510_15702_15824 Geobacillus kaustophilus HTA426 5S rRNA
381 :     TTGCCTAGTGGCTATGGCGGAGGGGAAACACCCGTTCCCATCCCGAACACGGAAGTTAAG
382 :     CCCTCCAGCGCCGATGGTAGTTGGGGCCAGCGCCCCTGCAAGAGTAGGTCGTTGCTAGGC
383 :     GAA
384 :     >237727.3:ErythNAP1.contigs_3_1132103_1132222 Erythrobacter sp. NAP1 5S rRNA
385 :     TTGCTTGGTGGTCATAGCGTCTGTGACCCACCCGATCCCATCTCGAACTCGGCCGTGAAA
386 :     CCAGATAGCGCCGATGGTACTGTGTCTTAAGGCACGGAAGAGTAGGTCGCCGCCAGGCAT
387 :     >242619.1:NC_002950_124844_124957 Porphyromonas gingivalis W83 5S rRNA
388 :     TTCAGGTGGTTATAACGTTGGGGATCCACCTCTTCCCATTCCGAACAGAGAAGTTAAGCC
389 :     CAACGGTGCCGATGGTACTGCGTCACAGTGGGAGAGTAGGACGCCGCCGTTTTT
390 :     >243090.1:NC_005027_4611312_4611202 Pirellula sp. 1 5S rRNA
391 :     TTCCGGCGATCATATCTTAAAGGTTATACCTGTTCCCATTCCGAACACAGCAGTCAAGCT
392 :     TTAAGAGCCGATGATAGTGCCCACCAGCGTGAAAGTAGGTCTTGCCGGATT
393 :     >243161.4:NC_002620_138687_138805 Chlamydia muridarum Nigg 5S rRNA
394 :     TTAGCTTGGTGATAATAGAGAGAGGGAAACACCTGATACCATTCCGAACTCAGAAGTTAA
395 :     GCCTCTGATCGCTGATGGTACTATACACAAGAGTATGGGAGAGTAGGTCGTTGCCAAGC
396 :     >243164.3:NC_002936_50767_50889 Dehalococcoides ethenogenes 195 5S rRNA
397 :     TCCCCCGGTGGTTAGAGCGGGGTGGTACCACCCGTTCCCGTCCCGAACACGGTCGTGAAA
398 :     CGCCCCAGCGCAGACGATACTTAGGAGGCAACTCCTTGTGGAAAATATGCCACTGCCCGG
399 :     GGA
400 :     >243230.1:NC_001263_254394_254514 Deinococcus radiodurans R1 5S rRNA
401 :     ACCCCCGTGCCCATAGCACTGTGGAACCACCCCACCCCATGCCGAACTGGGTCGTGAAAC
402 :     ACAGCAGCGCCAATGATACTCGGACCGCAGGGTCCCGGAAAAGTCGGTCAGCGCGGGGGT
403 :     T
404 :     >243231.1:NC_002939_689761_689881 Geobacter sulfurreducens PCA 5S rRNA
405 :     TTCTCGGTGGCTATGCCGAGGGGGTCACACCCGTTCCCATCTCGAACACGGAAGTTAAGC
406 :     CCCTCTGGGCCGATGATACTGCACGGGCAGCTGTGTGGGAAAGTAGGTCGCCGCCGGGAT
407 :     T
408 :     >243233.4:NC_002977_793177_793294 Methylococcus capsulatus str. Bath 5S rRNA
409 :     TGCCTGGCGGCCAGAGCGAGCGGGAACCACCCGATCCCATCCCGACCTCGGAAGTGAAAC
410 :     CGCTTAGCGCCGATGATAGTGCAGAATACCTGTGCGAAAGTAGGGAACTGCCAGGCTC
411 :     >243273.1:NC_000908_174685_174796 Mycoplasma genitalium G-37 5S rRNA
412 :     TGTTTGGTGCTAATATCGCTGTGGAAACACCTGGAACCATCCCGAACCCAGCAGTTAAGC
413 :     ACAGTGGAGCTAAATGTAGGTAGTAATACTGAGAATAGGTAAGCACCAAGCA
414 :     >243274.1:NC_000853_193827_193948 Thermotoga maritima MSB8 5S rRNA
415 :     CCCCGGGTGCCGATACTGGGGCGGGAAACACCCGGTTCCATTCCGAACCCGGCCGTTAAG
416 :     CCGCCCTGGGCCGATGGTAGTATGGGGGCAGCCCCATGCGAGAGTAGGTAGCGCCCGGGG
417 :     AT
418 :     >243275.1:NC_002967_615207_615319 Treponema denticola ATCC 35405 5S rRNA
419 :     CCAGGTGGCCATAGTGGAGAGGTAATACCCGTTCCCATCCCGAACACGGAAGTCAAGCTC
420 :     TCTTACGCCGATGATACTGCTGATCAAGTGGGAAAGTAGGATGCTGCCTGGCT
421 :     >243276.1:NC_000919_234945_235056 Treponema pallidum subsp. pallidum str. Nichols 5S rRNA
422 :     CCTGGTTGCCATGGTGGAGAGGTCATACCCGTTCCCATCCCGAACACGGAAGTCAAGCTC
423 :     TCCTACGCCGATGATACTGCTCCTTCGCGGGAAAGTAGGTAGTAGCCAGGCT
424 :     >243365.1:NC_005085_426447_426566 Chromobacterium violaceum ATCC 12472 5S rRNA
425 :     ATGTCTGGTGGCCATAGCGAGGTGGTCCCACGCCTTCCCATCCCGAACAGGACCGTGAAA
426 :     CGCCTTAGCGCCGATGATAGTGTGGCATTCGCCATGTGAAAGTAGGACACCGCCAGACGC
427 :     >243365.1:NC_005085_1652252_1652371 Chromobacterium violaceum ATCC 12472 5S rRNA
428 :     TTTTCTGGCGACCATAGCGAGATGGCCCCACGCCTTCCCATTCCGAACAGGACCGTGAAA
429 :     CATCTTAGCGCCGATGATAGTGTGGCATTCGCCATGTGAAAGTAGGACATCGCCAGATCT
430 :     >246194.3:NC_007503_1392791_1392672 Carboxydothermus hydrogenoformans Z-2901 5S rRNA
431 :     TTTCCGGTGGCCATAGCGGAGGGGAAACACCCGTTCCCATTCCGAACACGGCAGTTAAGC
432 :     CCTCCAGCGCCAATGGTACTGGGACGATAGGTCCCGGGAGAGTAGGTCGCTGCCGGAAAA
433 :     >246200.3:NC_003911_267353_267471 Silicibacter pomeroyi DSS-3 5S rRNA
434 :     GGTTTGGTGGTCATAGCGAGCGCAATACACCCGGTCCCTTCCCGAACCCGGAAGTTAAGT
435 :     GCCTCCGCGCCAATGGTACTCGGGCTCAAGCCCCGGGAGAGTAGGTCACCGCCAAACCT
436 :     >247156.1:NC_006361_1184663_1184782 Nocardia farcinica IFM 10152 5S rRNA
437 :     GTTACGGCGGTCATAGCGGTGGGGAAACGCCCGGTCCCATTCCGAACCCGGAAGCTAAGC
438 :     CTGCCAGCGCCGATGGTACTGCACTCGACAGGGTGTGGGAGAGTAGGACACCGCCGGAAC
439 :     >251221.1:NC_005125_1567916_1567798 Gloeobacter violaceus PCC 7421 5S rRNA
440 :     TTCCTGGTGCTCAGGCGCAGTGGAACCACGCCGATCCATCCCGAACTCGGACGTTAAACG
441 :     CTGCAGCAGCGAAGATACTTGGAGGGCAGCTTCCTGGGAAAATAGCCCGGTGCCAGGGA
442 :     >252305.3:ObatHTCC2597.contigs_13_173645_173764 Oceanicola batsensis HTCC2597 5S rRNA
443 :     TGGTCTGGTGGTCATAGCACAAGCGAAACACCCGATCCCATCCCGAACTCGGCCGTTAAG
444 :     CGCTGTCGCGCCAATGGTACTGCGTCTCAAGACGTGGGAGAGTAGGTCACCGCCAGACCT
445 :     >254945.3:NC_005295_1283687_1283570 Ehrlichia ruminantium str. Welgevonden 5S rRNA
446 :     GGGTTGGTGGTAATAGCAGAAGTGATACACCCAGCTACATTTCGAACCTGGAAGTTAAGC
447 :     CTTCTAGCGCTTATGGTACTTTGTCTTAAGGCACGGGAGAGTAGGTCGCTGCCACCCT
448 :     >257309.1:NC_002935_748458_748578 Corynebacterium diphtheriae NCTC 13129 5S rRNA
449 :     TGTGTTGGTGGTTATTGTGTCGGGGGTACGCCCGGTCCCTTTCCGAACCCGGAAGCTAAG
450 :     CCCGATTGCGCTGATGGTACTGCACCTGGGAGGGTGTGGGAGAGTAGGTCGCCGCCAACC
451 :     T
452 :     >257310.1:NC_002927_1978102_1978216 Bordetella bronchiseptica RB50 5S rRNA
453 :     GCCTGACGACCATAGCAAGGTGGTCCCACTCCTTCCCATCCCGAACAGGACAGTGAAACG
454 :     CCTTCGCGCCGATGATAGTGGATGTACATCTGTGAAAGTAGGTCATCGTCAGGCT
455 :     >258594.1:NC_005296_4992515_4992395 Rhodopseudomonas palustris CGA009 5S rRNA
456 :     CGGCCTGGTGGTTCTAGCGAGGAGCCTGAACCCGTTCCCATCCCGAACACGGCCGTTAAA
457 :     CTCCTCAGCGCCAATGGTACTCCGTCTCAAGACGCGGGAGAGTAGGTCGCCGCCAGGCCT
458 :     G
459 :     >259536.3:NC_007204_665719_665836 Psychrobacter sp. 273-4 5S rRNA
460 :     TTTGCTGACGACAATAGCACGATGGCCCCACCTGATCCCTTACCGAACTCAGAAGTGAAA
461 :     CATCGTCGCGCCAATGGTAGTGTGGTTCGCCCATGTGAGAGTAGGTCATCGTCAGCTC
462 :     >262723.3:NC_007294_647636_647530 Mycoplasma synoviae 53 5S rRNA
463 :     CAATAGTGGCCATAGCGAAGGTTTGCACCTGATACCATTCCGAACTCAGTAGTTAAGCCC
464 :     TTTAGCGCCTAAGATAGCTGAAAAGCAAAAATCGGGAGCTGCTTTTT
465 :     >262724.1:NC_005835_1537462_1537582 Thermus thermophilus HB27 5S rRNA
466 :     TCCCCCGTGCCCATAGCGGCGTGGAACCACCCGTTCCCATTCCGAACACGGAAGTGAAAC
467 :     GCGCCAGCGCCGATGGTACTGGGCGGGCGACCGCCTGGGAGAGTAGGTCGGTGCGGGGGA
468 :     T
469 :     >264198.3:NC_007347_1894082_1893966 Ralstonia eutropha JMP134 5S rRNA
470 :     ATGCCTGGTGACCATAGCGAGCTGGAACCACCCCTTCCCATCCCGAACAGGTCCGTGAAA
471 :     CAGCTCCGCGCCGATGATAGTGCGGATACCCGTGTGAAAGTAGGTCATCGCCAGGCT
472 :     >264201.1:NC_005861_1227394_1227275 Parachlamydia sp. UWE25 5S rRNA
473 :     TTCGTTTGGTGGCATTAGAGAAAGGGAAATACCTGAACCCATTCCGAACTCAGAAGTCAA
474 :     GCCTTTCATCGCCGATGGTACTGCACACAAGAGTGTGGGAGAGTAGGTCGCCGCCAAACT
475 :     >264203.3:NC_006526_1613059_1612939 Zymomonas mobilis subsp. mobilis ZM4 5S rRNA
476 :     TAGCTTGGTGGCTATAGCGTCAGTGACCCACCCGATCCCATTTCGAACTCGGACGTGAAA
477 :     CCTGTCCTGCGCCGATGGTACTGTTGCTTAAGCAACGGAAGAGTAGGTCGTCGCCAGGCT
478 :     T
479 :     >264462.1:NC_005363_824615_824735 Bdellovibrio bacteriovorus HD100 5S rRNA
480 :     TTTGCTGGTGTTTATAGCAGAGGGGCCACACCTGATCCCATTCCGAACTCAGAAGTTAAG
481 :     TCCTCTTGCGGCGATGGTATTGCATTGGTGACAATGTGGGAGAGTAGCACGACGCCAGCT
482 :     C
483 :     >264732.1:NZ_AADT02000007_5365_5483 Moorella thermoacetica ATCC 39073 5S rRNA
484 :     TTTCTGGTGGTAATAGCGGAGGGGAAACACCCGTTCCCATCCCGAACACGGCAGTTAAGC
485 :     CCTCCAGCGCCGATGGTACTGGGGAGTATTCCCCGGGAGAGTAGGACACCGCCAGGAAA
486 :     >265072.1:NZ_AADX01000005_167301_167183 Methylobacillus flagellatus KT 5S rRNA
487 :     ATGTCTGGCGGCCATAGCGAATTGGAACCACCCCTTCCCATCTCGAACAGGGCCGTGAAA
488 :     CGATTCCGCGCCAATGATAGTATGCACTACGCATGCGAAAGTAGGTCACCGCCAGGCTT
489 :     >265311.3:NC_006055_196560_196668 Mesoplasma florum L1 5S rRNA
490 :     ATCTGGTGGTCATAGCGTAGAGGTCACACCTGTTCCCATACCGAACACAGAAGTTAAGCT
491 :     CTACAGCGTCGACGATATTGCATTGTGAGAAAATAGAACGCTGCCAGTT
492 :     >266117.1:NZ_AAEB01000008_29174_29058 Rubrobacter xylanophilus DSM 9941 5S rRNA
493 :     AAGGGTGACGATAGCGGCGGGGATACACCTCTTCCCATTCCGAACAGAGAAGTTAAGCCC
494 :     GCCAGCGCCGATGGTACTGCGGGGGGGACCCCGTGGGAGAGTAGGTCGTCGCCCATT
495 :     >266940.1:NZ_AAEF01000001_19251_19371 Kineococcus radiotolerans SRS30216 5S rRNA
496 :     GTCCGGTGGTCATAGCGGTGGGGAAACGCCCGGTCTCATTCCGAACCCGGAAGCTAAGCC
497 :     CACCAGCGCCGATGGTACTGCTCGGGAGACTGGGTGGGAGAGTAGGTCACCGCCGGCCAC
498 :     T
499 :     >267608.1:NC_003295_1537733_1537847 Ralstonia solanacearum GMI1000 5S rRNA
500 :     GCCTGGTGACCATAGCGAGTCGGTACCACCCCTTCCCATCCCGAACAGGACCGTGAAACG
501 :     ACTCCGCGCCGATGATAGTGCGGATTCCCGTGTGAAAGTAGGTCATCGCCAGGCT
502 :     >267747.1:NC_006085_611077_611198 Propionibacterium acnes KPA171202 5S rRNA
503 :     TTTCCGGTGGCCATAGTGGAAGGGAAACACCCGGTCCCATTCCGAACCCGGTCGTTAAGC
504 :     CTTCCAACGCTGATGGTACTGCACGAGGGATCGTGTGGGAGAGTAAGACGCTGCCGGAAT
505 :     AC
506 :     >267748.1:NC_006908_260702_260596 Mycoplasma mobile 163K 5S rRNA
507 :     AACAAGCAACTATAGCAAGAGTGTACACCTGAACCCATTCCGAACTCAGTAGTTAAGCCT
508 :     CTTAGCGTCGAAGATACCAGTAATGGGAAAATAGAGCGTTGCTTTTT
509 :     >269484.4:NC_007354_1098918_1098799 Ehrlichia canis str. Jake 5S rRNA
510 :     GGGTTGGTGGTAATAGCGGAAGTGGTACACCCAGCTTACATTTCGAACCTGGAAGTTAAG
511 :     CCTTCTAGCGCTGATGGTACTTTGTCTTAAGGCACGGGAGAGTAAGTCACTGCCACCCTT
512 :     >269800.4:NC_007333_2386932_2386813 Thermobifida fusca YX 5S rRNA
513 :     GTTACGGCGGTCATAGCGGGCGGGGTCCACCCGGTCCCATTCCGAACCCGGTCGTTAAGC
514 :     CGCCCAGCGCCGATGGTACTGCCCTGTGGTGGGGTGGGAGAGTAGGACACCGCCGTACAC
515 :     >272558.1:NC_002570_123272_123388 Bacillus halodurans C-125 5S rRNA
516 :     GTTTGGTGGCGATAGCGAAGAGGCCACACCCGTTCCCATGCCGAACACGGTCGTTAAGCT
517 :     CTTCAGCGCCGATGGTAGTTGGGGGCTTCCCCCTGCGAGAGTAGGACGCTGCCAAAC
518 :     >272562.1:NC_003030_14377_14494 Clostridium acetobutylicum ATCC 824 5S rRNA
519 :     TCCGGTGACCATAGCTTGGTTGTAACACCCGTTCCCATACCGAACACGAAGGTTAAGAAC
520 :     CAAAGCGCCGATGGTACTGCAGGGGCAGCCCTGTGGGAGAGTAGGTCATTGCCGGGTA
521 :     >272562.1:NC_003030_168142_168260 Clostridium acetobutylicum ATCC 824 5S rRNA
522 :     TCCGGTGATCATAGCTTGGTTGTAACACCAGTTCCCATACCGAACACGAAGGTTAAGAAC
523 :     CAAAGCGCCGATGCGTACTGCAGGGGCAACCGTGTGTCAAATGAGGTCATTGCCGGGTA
524 :     >272621.3:NC_006814_63997_64113 Lactobacillus acidophilus NCFM 5S rRNA
525 :     TACGGTGGCGAAAGCAAGAAGGATACACCTGTTCCCATGCCGAACACAGAAGTTAAGCTT
526 :     CTTAACGCCGAAAGTAGTTGGTGGGCAACTGCCTGCGAGGATAGGAAGCTGCCGTGC
527 :     >272623.1:NC_002662_28694_28812 Lactococcus lactis subsp. lactis Il1403 5S rRNA
528 :     TATTTGGTATTTATTGCATAGGAGATATACCTGTTCCCATGTCGAACACAGAAGTCAAGT
529 :     CCTTTTGCGCTGGAAGTACTTGGGGGTTGCCCCCTGGGAGATAAAGACGATGCCAAGTT
530 :     >272623.1:NC_002662_542396_542512 Lactococcus lactis subsp. lactis Il1403 5S rRNA
531 :     ATTTGGTCATCATTGCGATGGAGATACACCTGTTCCCATGTCGAACACAGAAGTTAAGTC
532 :     CATCTACGGCGGAAGTACTTGGGGGTTGCCCCCTGGGAGATAGGCGAGTGGCCAAGT
533 :     >272624.3:NC_002942_364721_364842 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 5S rRNA
534 :     TTTCCTGGCGACTATAGCGATTTGGAACCACCTGATACCATCTCGAACTCAGAAGTGAAA
535 :     CATTTCCGCGCCAATGATAGTGTGAGGCTTCCTCATGCGAAAGTAGGTCATCGCCAGGGT
536 :     TT
537 :     >272632.1:NC_005364_83700_83591 Mycoplasma mycoides subsp. mycoides SC str. PG1 5S rRNA
538 :     ATCTGGTGGTTATAGCATAGAGGTCACACCTGTTCCCATGCCGAACACAGAAGTTAAGCT
539 :     CTATTACGGTGAAAATATTACTTATGTGAGAAGATAGCAAGCTGCCAGTT
540 :     >272633.1:NC_004432_1233295_1233188 Mycoplasma penetrans HF-2 5S rRNA
541 :     AATGCAGTGTTAATATTGTAGTGGAAACACCTGTTCCCATCCCGAACACAGAAGTTAAGC
542 :     ACTATGAAGCCAAAGGTAGCTTTTGCAAGAATAGGAAGATGCTGCTTA
543 :     >272634.1:NC_000912_122997_123107 Mycoplasma pneumoniae M129 5S rRNA
544 :     TGTTTGGTGCCCATGTCGCTGTGGAAACACCTGGTTCCATTTCGAACCCAGCAGTTAAGC
545 :     ACAGTGGAGCCGAATGTAGCTGTTTCAGTGAGAATAGGAAAGCACCAAGCG
546 :     >272635.1:NC_002771_260265_260369 Mycoplasma pulmonis UAB CTIP 5S rRNA
547 :     AACAAGTGACCATAACGCAAGTTATACCTGATACCATTCCGAACTCAGTAGTCAAGACTT
548 :     GTGGTGCCGACGATACCCGCTGGGGAAAATAGGGAGTTGCTTTTT
549 :     >272843.1:NC_002663_1937607_1937491 Pasteurella multocida subsp. multocida str. Pm70 5S rRNA
550 :     TTTTGGTAGCCATAGTGCAGCAGACCCACCTGAACCCATGCCGAACTCAGAAGTGAAATG
551 :     TTGTAACGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGTCACTACCAAAT
552 :     >272943.3:NC_007493_5110_5228 Rhodobacter sphaeroides 2.4.1 5S rRNA
553 :     GGTCTGGTGGCCATAGCACGAGCAAAACACCCGATCCCATCCCGAACTCGGCAGTTAAGT
554 :     GCCGTCGCGCCAATGGTACTGCGTCTCAAGACGTGGGAGAGTAGGTCGCCGCCAGACCT
555 :     >273119.1:NC_002162_150121_150227 Ureaplasma parvum serovar 3 ATCC 700970 5S rRNA
556 :     TGTGTAGTGATTATATCAGAGTGGAAATACCTGTTCCCATCCCGAACACAGAAGTCAAGC
557 :     ACTCTAGAGCCGAAAATAGCGCAAGTAAAATAGGTCATCGCTACGCT
558 :     >273121.1:NC_005090_141246_141368 Wolinella succinogenes DSM 1740 5S rRNA
559 :     TTTTTCTCGTGCCTATAGAGGAGAGGCTACACCCAGCTCCATTCCGAACCTGGCAGTTAA
560 :     GCTCTCCATCGCCGATAATACTGCATCTTTCAGGTGTGGAAACGTAGGTTGGTGCGGGGA
561 :     GGG
562 :     >283165.1:NC_005955_1173229_1173109 Bartonella quintana str. Toulouse 5S rRNA
563 :     TGACTTGGTGGTTATGGCGGAGCGAACGCACCCGATCCCATCCCGAACTCGGCCGTGAAA
564 :     CGTTCCAGCGCTGATGGTACTTTGCCTTAAGGCACGGGAGAGTAAGTCGCTGCCAGGTCT
565 :     G
566 :     >283942.3:NC_006512_1263018_1262897 Idiomarina loihiensis L2TR 5S rRNA
567 :     ATGTCTGGCGGCCATAGCGGTGTGGCACCACCTGAATCCATTCCGAACTCAGAAGTGAAA
568 :     CACACCAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGTCACCGCCAGACT
569 :     TT
570 :     >290633.1:NC_006677_238471_238352 Gluconobacter oxydans 621H 5S rRNA
571 :     AAGACTGGTGGCCATTGCGAGGGCCCTACACCCGATCCCATCCCGAACTCGGCCGTGAAA
572 :     TCCCTCAGCGCCTATGATACTGCACCTTAAGGTGCGGAAAAGTCGGTCGCCGCCAGGTCC
573 :     >291272.3:NC_007292_260445_260564 Candidatus Blochmannia pennsylvanicus str. BPEN 5S rRNA
574 :     TACTTGGTGGCATTAGCGCGATAGTACCACCTGATTCCATTTCGAACTCAGAAGTGAAAT
575 :     GTCGTAGTACCGATGGTAGTGTGGGGTGTCCTCATGCGAGAGTAGGGGGCTGCCAAGTAT
576 :     >292414.1:Contig49_319_436 Silicibacter sp. TM1040 5S rRNA
577 :     GGTTTGGTGGCCAAAGCACAAGCGAAACACCCGGTCCCTTCCCGAACCCGGAAGTTAAGC
578 :     GCTGTTGCGCCGATGGTACTGCATCTTAAGGTGTGGGAGAGTAGGGCACCGCCAAACC
579 :     >292415.3:NC_007404_483458_483574 Thiobacillus denitrificans ATCC 25259 5S rRNA
580 :     TGTCTGACGACCATAGCAGAGTGGAACCACCCCTTCCCATCCCGAACAGGACGGTGAAAC
581 :     GCTCCCGCGCCAATGATAGTAGGCATTCGCCTGTGAAAGTAGGTCATCGTCAGACTC
582 :     >296591.1:3634502_Cont45_275013_274897 Polaromonas sp. JS666 5S rRNA
583 :     ATGCCTGATGACCATAGCAAGTTGGTACCACTCCTTCCCATCCCGAACAGGACAGTGAAA
584 :     CGACTTAGCGCCGATGATAGTGCGGATTCCCGTGTGAAAGTAGGACATCGTCAGGCT
585 :     >298386.1:NC_006370_74714_74834 Photobacterium profundum SS9 5S rRNA
586 :     TTGTCTGGCGACCATAGCGCTGTGGCTCCACCTGATCCCATGCCGAACTCAGAAGTGAAA
587 :     CGCAGTTGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGGCATCGCCAGGCC
588 :     C
589 :     >298386.1:NC_006370_785386_785506 Photobacterium profundum SS9 5S rRNA
590 :     TTACTTGGCGACAATAGCACTATAGAACCACCTGATCCCATGCCGAACTCAGAAGTGAAA
591 :     TATAGTTGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGTCATTGCCAAGTT
592 :     C
593 :     >306537.3:NC_007164_113847_113968 Corynebacterium jeikeium K411 5S rRNA
594 :     TTTGTCGGTGGTTGTTAGCGGTGGGGTCACGCCCGGTCCCTTTCCGAACCCGGAAGCTAA
595 :     GCCTACCTGCGCTGATGGTACTGCACCTGGGAGGGTGTGGGAGAGTAAGTCACCGCCGGC
596 :     AC
597 :     >313589.3:JaniHTCC2649.contigs_7_728_849 Janibacter sp. HTCC2649 5S rRNA
598 :     GTTTCGGCTGTCATAGCGAAGGGGAAACGCCCAGCTCCATTCCGAACCTGGAAGCTAAGC
599 :     CCTTCAGCGCCGATGGTACTGCACTGGTGACGGTGTGGGAGAGTAGGACGCAGCCGGACA
600 :     AT
601 :     >313590.3:CellMED134.contigs_1_232641_232750 Cellulophaga sp. MED134 5S rRNA
602 :     TAAGGTGGTTATAGCGACGGGGCTCACCTCTTCCCATTCCGAACAGAGAAGTTAAGCCCG
603 :     CCAGCGCCGATGGTACTGCACTCGTGGGAGAGTAGGTCGCCGCCTTTTTA
604 :     >313593.3:FlavoMED217.contigs_12_9509_9399 Flavobacterium sp. MED217 5S rRNA
605 :     TAAGGTGGTTATAGCGACGGGGCTCACCTCTTACCATTCCGAACAGAGTAGTTAAGCCCG
606 :     TTAGCGCCGATGGTACTACATCTCGTGGGAGAGTAGGTCGCCGCCTTGTTT
607 :     >313598.3:TenaciMED152.contigs_1_5579_5690 Tenacibaculum sp. MED152 5S rRNA
608 :     TAGGGTGGTTATAGCATTGGGGCTCACCTCTTCCCATACCGAACAGAGAAGTTAAGCCCA
609 :     ATAGCGCCGATGGTACTGCATTTATGTGGGAGAGTAGGTCGCTGCCTTTCTT
610 :     >314225.3:ElitHTCC2594.contigs_8_796756_796637 Erythrobacter litoralis HTCC2594 5S rRNA
611 :     TTGCTTCGTGGTCCTAGCGCCTGTGACCCACCCGATCCCATCTCGAACTCGGCCGTGAAA
612 :     CCAGGCAGCGCCGATGGTACTAGTGCTCAAGCACTGGAAGAGTAGGTCACCGCGAGGCAT
613 :     >314232.3:LvestSKA53.fas_1_156_275 Loktanella vestfoldensis SKA53 5S rRNA
614 :     TGGTTTGGTGGTCATAGCGCGAGCAAAACACCCGATCCCATCCCGAACTCGGCAGTTAAG
615 :     TGCCGCAGCGCTGATGGTACTGCGTCTTAAGACGTGGGAGAGTAAGTCACTGCCAAACCT
616 :     >314254.3:OalexHTCC2633.contigs_14_277_398 Oceanicaulis alexandrii HTCC2633 5S rRNA
617 :     CGACCGGGTGGTTATAGCGAAGGCTCCACACCCGTTCCCATCCCGAACACGGCCGTTAAG
618 :     ACCTTCTGCGCCAATGGTACTATGTCCTAAGGCATGGGAGAGTAGGTCGCCGCCCGGTCC
619 :     GC
620 :     >314260.3:PbermHTCC2503.contigs_4_403049_402929 Parvularcula bermudensis HTCC2503 5S rRNA
621 :     CGGCCCGGTGATTATTGCGCGGGGCCCCCACCTGATCCCATCTCGAACTCAGCCGTTAAA
622 :     TCCCGCAGCGCCGATGGTACTTCGTCTCAAGGCGTGGGAGAGTAGGTCGTCGCCGGGCCT
623 :     G
624 :     >314262.3:RoseMED193.contigs_11_191757_191638 Roseobacter sp. MED193 5S rRNA
625 :     TGGTTTGGTGGCGATAGCGAGAGCAAAACACCCGGTCCCATCCCGAACCCGGAAGTTAAG
626 :     TGCCTTTGCGCCAATGGTACTGCGGCTTAAGTCGTGGGAGAGTAGGTCACTGCCAAACCT
627 :     >314271.3:RhodoHTCC2633.contigs_31_33810_33929 Rhodobacterales bacterium HTCC2654 5S rRNA
628 :     TGGTGTGGTGGTCATAGCGCGAGCAAAACACCCGGCTCCATCCCGAACCCGGCCGTTAAG
629 :     TGCCGTAGCGCCGATGGTACTGCGTCTTAAGACGTGGGAGAGTAGGTCACCGCCACACCT
630 :     >314276.3:IbalOS145.contigs_13_3968_3848 Idiomarina baltica OS145 5S rRNA
631 :     ATGTCTGGCGGCCATAGCGGTATGGCACCACCTGGCTCCATTCCGAACCCAGAAGTGAAA
632 :     CATACCAGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGACACCGCCAGACT
633 :     T
634 :     >314315.3:NC_007576_310982_311098 Lactobacillus sakei subsp. sakei 23K 5S rRNA
635 :     TGTGGTGGCGATAGCAAGAAGGATACACCTGTTCCCATGTCGAACACAGTAGTTAAGCTT
636 :     CTTAGCGCCGATAGTAGTTGGTGGGAAACTACCTGCGAGGATAGGACGTTGCCACGC
637 :     >318161.3:NZ_AAIU01000061_12329_12209 Shewanella denitrificans OS-217 5S rRNA
638 :     TTGTCTGGAAACCATAGAGCTGTGGCACCACCTGATCCCATTCCGAACTCAGAAGTGAAA
639 :     CACAGTATCGCCGATTGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGTCATTTCCAGGCG
640 :     C
641 :     >319225.3:NC_007512_112720_112831 Pelodictyon luteolum DSM 273 5S rRNA
642 :     TTACGGCGACTATTTCCCAGGTGATCACCTCTTCCCATTCCGAACAGAGTAGTTAAGCCC
643 :     TGGAGAGCCGATGGTACTGCTTTACTGCGGGAGAGTAGGTCGTCGCCGAGTT
644 :     >323261.3:NC_007484_1004555_1004674 Nitrosococcus oceani ATCC 19707 5S rRNA
645 :     TTGCCTGGTGGCCATAGCGAGTAGGCCCCACCCGATCCCATTCCGAACTCGGAAGTGAAA
646 :     CTGCTCAGCGCCGATGATAGTGTGGGGTTACCCATGTGAAAGTAGGTCACTGCCAGGCGC
647 :     >323850.3:Contig152_174673_174553 Shewanella sp. PV-4 5S rRNA
648 :     TTGTCTGGAAACCATAGCATTGTGGTCCCACCTGATCCCATCCCGAACTCAGAAGTGAAA
649 :     CGCAATCGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGTCATTTCCAGGCG
650 :     C
651 :     >326297.3:NZ_AAIN01000060_5571_5451 Shewanella amazonensis SB2B 5S rRNA
652 :     TTGCTTGGTGACAATAGCGCTCTGGTCCCACCTGATCCCATTCCGAACTCAGCAGTGAAA
653 :     CGGAGCAGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGTCATTGCCAAGCG
654 :     C
655 :     >326297.3:NZ_AAIN01000004_294320_294199 Shewanella amazonensis SB2B 5S rRNA
656 :     TTGCTTGGAAACCATAGCGCTGTGGTCCCACCTGATCCCATTCCGAACTCAGTAGTGAAA
657 :     CGCAGTAGCGCCGATGGTAGTGTGGGGCCTCCCCATGTGAGAGTAGGACATTTCCAGGCT
658 :     TC
659 :     >326298.3:NC_007575_458176_458295 Thiomicrospira denitrificans ATCC 33889 5S rRNA
660 :     TTGTCTAGGTGGCTATAGAGAGAGGGAAACGCCTGGTCCCATTCCGAACCCAGAAGCTAA
661 :     GCCTCTCATCGCTGATAATACTGATCCTTGCAGGATTGGAAATGTAGGTCGCTGCCTAGT
662 :     >326442.4:NC_007481_40346_40466 Pseudoalteromonas haloplanktis TAC125 5S rRNA
663 :     TTGCTTGGTAACAATAGCGTTTTGGACCCACCTGACCCCATGCCGAACTCAGTAGTGAAA
664 :     CGAAACAGCGCCGATGATAGTGTAGCATTTGCTATGTGAAAGTAGGACATTGCCAGGCTC
665 :     C
666 :     >335992.3:NC_007205_564530_564648 Candidatus Pelagibacter ubique HTCC1062 5S rRNA
667 :     TCGCCGGTGATTATTGCGAAGGGGTTATACCCGATCCCATTCCGAACTCGGAAGTCAAGC
668 :     CCTTCAGCGCCAATGGTACTTTGTCTTAAGACACGGAAGAGTAGGACATTGCCGGCTAT
669 :     >97084.1:vorax50d06.q1k_799_918 Bacteriovorax marinus SJ 5S rRNA
670 :     TTTGGGTGTGTCGATAGCGACGAGGAAATACCTGATCCCATCCCGAACTCAGAAGTCAAG
671 :     CTCGTCAGCGGCGAAAGTAGTGCCAGGGGGACTTGGTGTGAGGCTAGCACGATGCACCCA
672 :     >224326.1:NC_001318_435312_435201 Borrelia burgdorferi B31 5S rRNA
673 :     CCCTGGTGGTTAAAGAAAAGAGGAAACACCTGTTATCATTCCGAACACAGAAGTTAAGCT
674 :     CTTATTCGCTGATGGTACTGCGAGTTCGCGGGAGAGTAGGTTATTGCCAGGG
675 :     >262719.3:NC_007295_783291_783397 Mycoplasma hyopneumoniae J 5S rRNA
676 :     TAAGAGTAACAATAGCAAAAGGGATCACCTGAATCCATTCCGAACTCAGTAGTTAAGCCT
677 :     TTTTACGCCGAAGATACTAGAAATAGGAAAATAGGGAGTTACTCTTT
678 :     >292459.1:NC_006177_25927_26036 Symbiobacterium thermophilum IAM 14863 5S rRNA
679 :     TTGGGTGGCGATGCCGGAGGGGATCACCCGTTCCCATTCCGAACACGGAAGTTAAGCCCT
680 :     CCAGGGCCGAAGGTACTCCGCAAGGGGGAGAATAGGTCGCTGCCCAAACT
681 :     >955.1:culex74f02.p1k_10677_10566 37716 bp, 485 reads, 66.21 AT
682 :     TGACTTGGTGGCTATAGCAAAAATGAACCACCCGATCTCATTTCGAACTCGGAAGTGAAA
683 :     CTTTTTAGCGCCGATGATACTTAAAAAGGGAAAGTAGGTCGTTGCCAAGTTT
684 :     >163164.1:NC_002978_185257_185368
685 :     TGACTTGGTGGCTATAGCAAAAATGAACCACCCGATCTCATCTCGAACTCGGAAGTGAAA
686 :     CTTTTTAGCGCTGATGGTACTTGAAAAGGGAGAGTAGGTCGCCGCCAAGTTT
687 :     >292805.3:NC_006833_899485_899374
688 :     TAACTTGGTGGTTTTAGCAAAAATGAAACACCCGATCCCATCTCGAATTCGGAAGTGAAA
689 :     CTTTTTAGCGCTGATGGTACTTGAAAAGGGAGAGTAGGTCGCTGCCAAGTTT
690 :     >262768.1:NC_005303_560382_560268
691 :     ATCCTTGGTGCATAAAACTAAGGGGCAACACCTGTTCCCATCCCGAACACAGCAGTTAAG
692 :     TCCTTAGTACTGACAATAGTTCTTTATTGAGCGAAGATAGGGAGTGCCAAGGTTT
693 :     >273035.1:spiro.fasta.screen.Contig78_7105_6993
694 :     TAATCTGGTGCTTATGGCATAGTGGACACACCCGTTCCCATCCCGAACACGGAAGTTAAG
695 :     CACTATTACGCCGATGATAGCCGCAAGGTGAAAATAGGTCAGTGCCAGGTTAA

MCS Webmaster
ViewVC Help
Powered by ViewVC 1.0.3