[Bio] / FigKernelPackages / 5S_rRNA_reps.pm Repository:
ViewVC logotype

View of /FigKernelPackages/5S_rRNA_reps.pm

Parent Directory Parent Directory | Revision Log Revision Log


Revision 1.1 - (download) (as text) (annotate)
Sat Jan 7 00:30:01 2012 UTC (8 years, 4 months ago) by golsen
Branch: MAIN
CVS Tags: mgrast_version_3_2
A set of 5S rRNA sequences.

#
# 5S_rRNA_reps
#
package RNA_reps;
use strict;
use gjoseqlib;

our @RNA_reps         = read_fasta( \*DATA );
our $assignment       = '5S rRNA ## 5S ribosomal RNA';
our $tag              = '5S_rRNA';
our $max_expect       = 1e-10;
our $max_exptrapolate = 10;
our $min_coverage     = 0.70;
our $min_identity     = 0.50;


__DATA__
>217.1:must36b10.q2kA37_79628_79747 Helicobacter mustelae 43772 5S rRNA
TTCCTTGTGTCTATAGAGAGAAGGAAACACCCAGCTCCATTCCGAACCTGGCAGTTAAGC
TTCTCTTCGCTGATGATACTGCACCTTTCAGGTGTGGGAACGTAGGTCGATGCAGGGTTA
>235.1:Contig0323_176_296 Brucella abortus 5S rRNA
CGACCTGGTGGTTATGGCGGAGCGGCTGCACCCGATCCCATTCCGAACTCGGCCGTGAAA
CGCTCCAGCGCCAATGGTACTTCGTCTCAAGACGCGGGAGAGTAGGTCGCTGCCAGGTCT
G
>263.2:Francisella_tularensis_Holarctica_strain_LVS_129447_129563 Francisella tularensis (Livermore) 5S rRNA
TTTTGGCGATGATAGCTTGTAGGAACCACCTGATCCCATTCCGAACTCAGAAGTGAAACT
ACAAAACGCCGATGATAGTCTGGCATTGCCCAGGTGAAAGTAGGTAATTGCCATCTT
>263.2:Francisella_tularensis_Holarctica_strain_LVS_450182_450298 Francisella tularensis (Livermore) 5S rRNA
CATTGACGATGATAGCAGTCTGGAACCACCTGATCCCATTCCGAACTCAGAAGTGAAACG
GTCTCACGCCAATGATAGTCTGGCACTGCCCAGGTGAAAGTAGGTAATCGTCAAACC
>354.1:NZ_AAAU02000010_132184_132064 Azotobacter vinelandii 5S rRNA
TTGCTTGACGATCATAGAGCGTTGGAACCACCTGATCCCATCCCGAACTCAGCAGTGAAA
CGACGCATCGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGTCATCGTCAAGCG
C
>486.1:lact216g03.p1k_28752_28869 Neisseria lactamica ST-640 5S rRNA
AGTTTGGCGGCCATAGCGAGTTGGTCCCACGCCTTCCCATCCCGAACAGGACCGTGAAAC
GACTCAGCGCCGATGATAGTGTGGTTCTCCCATGCGAAAGTAGGTCACTGCCAAACAC
>521.1:Bav015d01.p2kA7_922_1038 Bordetella avium 5S rRNA
ACGCCTGACGACCATAGCAAGGTGGCCCCACTCCTTCCCATCCCGAACAGGACAGTGAAA
CGCCTTCGCGCCGATGATAGTTGGTTTACGCCTGTGAAAGTAGGTCATCGTCAGGCT
>584.1:mira251d08.p1k_3620_3499 Proteus mirabilis HI4320 5S rRNA
TTGCTTAGCGGCCATAGCGCGGTGGTCCCACCTGATCCCATGCCGAACTCAGAAGTGAAA
CGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGGAACTGCTAAGCA
TT
>594.1:gall372c09.p1k_10463_10343 Salmonella enterica subsp. enterica serovar Gallinarum 5S rRNA
TTGTCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAA
CGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGACA
T
>783.1:NZ_AADJ01000001_289108_289227 Rickettsia rickettsii 5S rRNA
TAGCTTGGTGGTTATAGCATGAGTGAAACACACGATCCCATCCCGAACTCGAATGTGAAA
CCTCATAGCGCTAATGGTACTATGTCATAAGGCATGGGAGAGTAAGTCGCTGCCAAGCTT
>817.1:Bf638R-448a02.p1k_24036_24148 Bacteroides fragilis 638R 5S rRNA
TCAGGTGACTATAGCATCAGGGTTCCACCTCTTCCCATTCCGAACAGAGAAGTTAAGCCT
GATCACGCCGATGGTACTGCGTAACAGTGGGAGAGTAGGTAGTCGCCGTTTTT
>817.2:Contig0092_137456_137565 Bacteroides fragilis NCTC9343 5S rRNA
GTAAGTGATTATAGCACAAGGGTTCCACCTCTTCCCATTCCGAACAGAGAAGTTAAGCCT
TGTCACGCCGATGGTACTGCATAATAGTGGGAGAGTAGGTAGTCGCCAGC
>882.1:NC_002937_110870_110985 Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough 5S rRNA
CCTGGCGTCCATGGAGGAGGGGGTACACCCGATCCCATTCCGAACTCGGAAGTTAAGCCC
TCCATCGCCGATGATACTGCGGGGTAGCTCGTGGGAAAGTAGGCCGACGCCAGGAC
>891.1:Contig3_532_648 Desulfuromonas acetoxidans 5S rRNA
GTCTGGTGGCGATAGCCAAGTGGTCACACCCGTTCCCATGCCGAACACGGAAGTTAAGCA
CTTGAACGCCGAAAGTAGTTGGGGGCTTCCCCCTGTGAGGATAGGACGCTGCCAGGC
>891.1:Contig321_32628_32512 Desulfuromonas acetoxidans 5S rRNA
TTCGGTGGCTATAGCACAGAGGTCACACCTGTTCCCATCTCGAACACAGAAGTTAAGCTC
TGTTGCGCCGATGATACTGCATGGGCAACTATGTGGGAAAGTAGGTCGCCGCCGAAT
>891.1:Contig324_21881_21764 Desulfuromonas acetoxidans 5S rRNA
TTTCGGTGGCTATAGCGCAGGAGTCACACCTGTTCCCATCCCGAACACAGAAGTTAAGCC
CTGCCGCGCCGATGATACTGCACGGGTGACTGTGTGGGAAAGTAGGTCGCCGCCGAAA
>985.1:NZ_AABD03000002_619_732 Cytophaga hutchinsonii 5S rRNA
TAATGGTGGCTATAGCGTTGGTGTTCACCTCTTCCCATTTCGAACAGAGAAGTTAAGCCC
AACTGCGCCAATGGTACTGCAGTCAAATGTGGGAGAGTAGGTCGCTGCCAACTT
>1085.1:NZ_AAAG02000001_1070120_1069999 Rhodospirillum rubrum 5S rRNA
TGGCCTGGTGGTCATTGCGGGCTCGAAACACCCGATCCCATCCCGAACTCGGCCGTGAAA
GAGCCCTGCGCCAATGGTACTGCGTCTTAAGGCGTGGGAGAGTAGGTCGCCGCCAGGCCT
TC
>1140.3:NC_007604_573571_573690 Synechococcus elongatus PCC 7942 5S rRNA
TCCTGGTGTCTATGGCGGTATGGAACCACTCTGACCCCATCCCGAACTCAGTTGTGAAAC
ATACCTGCGGCAACGATAGCTCCCGGGTAGCCGGTCGCTAAAATAGCTCGACGCCAGGTC
>1148.1:NC_000911_2448767_2448646 Synechocystis sp. PCC 6803 5S rRNA
TTCTTGGTGTCTTTAGCGTCATGGAACCACTCCGATCCCATCCCGCACTCGGTTGTGAAA
TGTGACAGCGGCGACGATACTCTGGGGGTTGCCCCACGGCACAATAGTCCGATGCCAAGT
TC
>1255.1:scaffold_15_422_538 Pediococcus pentosaceus 5S rRNA
TGTGGTGACGATAGTGAGAAGGATATACCTGTTCCCATGTCGAACACAGAAGTCAAGCTT
CTTAACGCCGAGAGTAGTTGGGGGATCGCCCCCTGCGAGGGTAGGACGTTGCCATGC
>1314.1:Contig0001_1789_1906 Streptococcus pyogenes M5 5S rRNA
AGTTAAGTGACGATAGCCTAGGAGATACACCTGTACCCATGCCGAACACAGCAGTTAAGC
CCTAGAACGCCTGATGTAGTTGGGGGTTGCCCCCTGTGAGATAAGGTAGTCGCTTAGC
>1491.1:Contig0003_534_650 Clostridium botulinum ATCC 3502 5S rRNA
TCTGGTGATTATGGCTTGAAGGTAACACCCGTTTCCATGCCGAACACGAAGGTTAAGCTT
CAAAGCGCTGATGGTACTGCAGGGGAAGCCCTGTGGAAGAGTAGGTCGTTGCCAGAT
>1496.1:CDCP114a04.p2cc9_53855_53736 Clostridium difficile 630 5S rRNA
TATGTGGTTATAATAGCAAAGAGGATACACCTGTTCCCATTCCGAACACAGAAGTTAAGC
TCTTTAGCGCTGATGGTACTTGGTGGGAAACTGCCTGGGAGAGTAGGACGTAGCCACGTG
>1596.1:NZ_AAAO02000003_69606_69722 Lactobacillus gasseri 5S rRNA
TACGGTGGCGATGGCAAGAAGGATACACCTGTTCCCATGCCGAACACAGAAGTTAAGCTT
CTTAACGCCGAGAGTAGTTGGTGGGAAACTGCCTGCGAGGGTAGGCAGTCGCCGTGC
>1806.1:micro376a11.q1k_13360_13245 Mycobacterium microti OV254 5S rRNA
GTTACGGCGGCCACAGCGGCAGGGAAACGCCCGGTCCCATTCCGAACCCGGAAGCTAAGC
CTGCCAGCGCCGATGATACTGCCCCTCCGGGTGGAAAAGTAGGACACCGCCGAACA
>31964.1:clav-201h02.q1ka_18957_18836 Clavibacter michiganensis 5S rRNA
GTTTCGGCGGCCATAGCGAGAGGGAAACGCCCGGTAACATTCCGAACCCGGAAGCTAAGA
CTCTCAGCGCCGATGGTACTGCAGGGGGGACCCTGTGGGAGAGTAGGACACCGCCGGACT
TA
>36870.1:NC_004344_141380_141499 Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis 5S rRNA
TTCCTGACAATATTATCGCGATAGAACCACCTGAATCCATACCGAACTCAGAAGTGAAAT
GTCGTAGTTCCGATGGTAGTGTGAGGTTTCCTTATGTGAGAGTAGGAGATTGTCAGGAAA
>36873.1:2351477_fasta.screen.Contig683_352_469 Burkholderia xenovorans LB400 5S rRNA
ATGCCTGATGATCATAGCGAGTCGGTCCCACCCCTTCCCATCCCGAACAGGACCGTGAAA
CGACTCCACGCCGATGATAGTGCGGATTACCCGTGTGAAAGTAGGTCATCGTCAGGCT
>39765.1:3634493_Cont40_33724_33842 Thiomicrospira crunogena XCL-2 5S rRNA
TGCTTGGGGACAATAGCAAGATGGAACCACCTGATCCCTTTCCGAACTCAGAAGTGAAAC
GTCTTAGCGCCGATGGTAGTGTGTCAGGTGGCATGTGAGAGTAGGTCATCCCCAAGCTT
>40324.1:malt282b03.p1k_622_740 Stenotrophomonas maltophilia K279a 5S rRNA
TCCCTGGTGAAATTAGCGCTGTGGAACCACCCGATCCCATCCCGAACTCGGAAGTGAAAC
GCAGCTGCGCCGATGGTAGTGTGGCTCAAGCCATGCGAGAGTAGGTCATCGCCAGGGTT
>48935.1:NZ_AAAV01000115_1018_899 Novosphingobium aromaticivorans 5S rRNA
TTGCCTGGTGGCCATAGCGTCCGTGCCCCACCCGATCCCATCTCGAACTCGGCCGTGAAA
CCGGACAGCGCCAATGGTACTAACGCTCAAGCGTTGGAAGAGTAGGTCGTCGCCAGGCAT
>52598.3:SulfEE36.contigs_4_5975_6093 Sulfitobacter sp. EE-36 5S rRNA
GGTTTGGTGGTCATAGCGTAAGCAAAACACCCGATCCCATCCCGAACTCGGCAGTTAAGT
GCTACTGCGCCAATGGTACTGCGTCTTAAGACGTGGGAGAGTAGGTCACCGCCAAACCT
>59919.1:NC_005072_318012_318131 Prochlorococcus marinus subsp. pastoris str. CCMP1986 5S rRNA
ATCCTGGTGTTCATGGCGATGTGGAACCACTCCGATCCATCTCGAACTCGGTTGTGAAAC
GCATCAGCGGCGAAAATATTTAGGGGGTAGCCCCTTGAGAAAATAGCTCAATGCCAGGTA
>62977.3:NC_005966_23620_23738 Acinetobacter sp. ADP1 5S rRNA
TTTGCTGGCGACAATAGCAAGAGTGAACCACCTGATCCCTTCCCGAACTCAGAAGTGAAA
CCTCTTCGCGCTGATGGTAGTGTGGCGTTAGCCATGTGAGAGTAAGTCATCGCCAGCTT
>63737.1:NZ_AAAY02000002_75043_74923 Nostoc punctiforme PCC 73102 5S rRNA
TTCCTGGTGTCTATTGCGCGGTGGAACCACACTGAACCCTTCCCGAACTCAGAGGTGAAA
CGCTGTTGCGGCAACGATAGTTTAGGGGTCGCCCTACGCAAAAATAGCTCGGTGCCAGGT
A
>66692.3:NC_006582_16729_16851 Bacillus clausii KSM-K16 5S rRNA
AGAGTCCGGTGACAATGGCAAAGAGGTCACACCCGTTCCCATGCCGAACACGGCCGTTAA
GCTCTTTTGCGCCGATGGTAGTTGGAGGCTTCCTCCTGTGAGAGTAGGACGTTGCCGGGC
AAA
>66692.3:NC_006582_263223_263342 Bacillus clausii KSM-K16 5S rRNA
TAAGTTCGGTGGCAATGGCAAAGAGGTCACACCCGTTCCCATGCCGAACACGGTCGTTAA
GCTCTTTTGCGTCGATGGTAGTTAGGGGCTTCCCCTTGCGAGAGTAGAACGCTGCCGGAC
>68909.1:3634504_Cont108_51084_51204 Deinococcus geothermalis DSM11300 5S rRNA
ACCCCCGTGCCTTGAGCGCCGTGGAACCACCCCATCCCATGCCGAACTGGGTCGTGAAAC
GCGGCAGCGCCTATGCTACTCGGACCGCAGGGTCCCGGAAAAGTCGGTCAGCGCGGGGGT
T
>71421.1:NC_000907_123555_123437 Haemophilus influenzae Rd KW20 5S rRNA
ATCCTGGCGGCGATAGTGCGGTGGACCCACCTGAGACCATACCGAACTCAGAAGTGAAAC
GCTGTAATGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGGCACCGCCAGGTT
>71421.1:NC_000907_629394_629511 Haemophilus influenzae Rd KW20 5S rRNA
TTTTGGCAGAGATAGTGCAATAGATCCACCTGAGACCATACCGAACTCAGAAGTGAAATG
TTGTAACGCTGATGGTAGTGTGGGGGTTCCCCATGTGAGAGTAAGGCACTGCCAATCG
>76114.4:NC_006513_545404_545289 Azoarcus sp. EbN1 5S rRNA
AGTCTGACGACCATAGCGTCCTGGCACCACCCCTTCCCATCCCGAACAGGACCGTGAAAC
AGGACCGCGCCGATGATAGTGCCTAAACGGGTGCGAAAGTAGGTCATCGTCAGACT
>83555.1:cab-33g11.p2k1028_268044_267925 Chlamydophila abortus 5S rRNA
TTTGCTTGGTGATAATGGAAAAAGGGATACACCTGATACCATTCCGAACTCAGAAGTTAA
GCCTTTTATCGCCGATGGTACTATACACAAGAGTATGGGAGAGTAGGTCGTCGCCAAGCT
>85962.1:NC_000915_448458_448577 Helicobacter pylori 26695 5S rRNA
TCCTTGTGCCTTTAGAGAAGAGGAACTACCCAGTTAACCATTCCGAACCTGGAAGTCAAG
CTCTTCATCGCTGATAATACTGCTCTTTTCAAGAGTGGGAATGTAGGTCGGTGCAGGGAT
>89187.3:RnubISM.contigs_3_1545612_1545730 Roseovarius nubinhibens ISM 5S rRNA
GGTTTGGTGGTCATAGCACAAGCGAAACACCCGGTCCCATCCCGAACCCGGCCGTTAAGC
GCTGTCGCGCCGATGGTACTGCGACTTAAGTCGTGGGAGAGTAGGTCACCGCCAAACCT
>93062.4:NC_002951_534059_534174 Staphylococcus aureus subsp. aureus COL 5S rRNA
GTCTGGTGACTATAGCAAGGAGGTCACACCTGTTCCCATGCCGAACACAGAAGTTAAGCT
CCTTAGCGTCGATGGTAGTCGAACTTACGTTCCGCTAGAGTAGAACGTTGCCAGGC
>100226.1:NC_003888_1468710_1468589 Streptomyces coelicolor A3(2) 5S rRNA
GTTTCGGTGGTCATAGCGTAGGGGAAACGCCCGGTTACATTTCGAACCCGGAAGCTAAGC
CTTACAGCGCCGATGGTACTGCAGGGGGGACCCTGTGGGAGAGTAGGACGCCGCCGAACT
CC
>103690.1:NC_003272_2382092_2382212 Nostoc sp. PCC 7120 5S rRNA
TTCCTGGTGCCTATGGTGCAGTGGTACCACTCTGACCCCATCCCGAACTCAGAGGTGAAA
CGCTGCTATGGCTACGATAGTCTAGGGGTTGCCCTATGCCACAATCGCTCGGTGCCAGGT
T
>107806.1:NC_002528_539430_539310 Buchnera aphidicola str. APS (Acyrthosiphon pisum) 5S rRNA
TTCCTGGTAAAAATAGTGTAGTGGTACCACCTGAATCCATTCCGAACTCAGAAGTGAAAC
GCTATAACGCCGATGGTAGTACGGGGCCTCCCCGTGTGAGAGTAGGTCAAATCCAGGAAA
A
>115711.1:NC_002179_1066053_1065934 Chlamydophila pneumoniae AR39 5S rRNA
TTAGCTTGGCGATACTGGAGAAAGGGATACACCTGATACCATTCCGAACTCAGAAGTTAA
GCCTTTTATCGCTGATGGTACTATACACAAGAGTATGGGAGAGTAAGTCGTTGCCAAGCT
>155920.1:NZ_AAAM01000002_5148_5264 Xylella fastidiosa Ann-1 5S rRNA
TCCCTGGTGATATTAGCGCTGTGGAACCACCCGATCCCATCCCGAACTCGGAAGTGAAAC
GCAGCTGCGCCGATGGTAGTGTGGGTCTCCCATGCGAGAGTAGGTCATTGCCAGGGT
>156405.1:Contig11_1121_1010 uncultured Chlorobi bacterium 5S rRNA
TTACGGCGACTATGTCTCAGGTGATCACCTCTTCCCATTCCGAACAGAGTCGTTAAGCCC
TGATGAGCCGATGGTACTGCTTAACTGCGGGAGAGTAGGTCGTCGCCGAATT
>156889.1:NZ_AAAN02000020_62909_62792 Magnetococcus sp. MC-1 5S rRNA
TTTCCGGTAGAGATAGCGAGGGAGTCACACCCGATCCCATCCCGAACTCGGAAGTTAAGC
CCCTTAGCGCCGATGATACTGCGTCTTAAGACGTGGGAAAGTAGGACACCGCCGGAAA
>159087.4:NC_007298_81794_81910 Dechloromonas aromatica RCB 5S rRNA
CGTCTGGCGTCAATAGCCTGCTGGTACCACCCCTTCCCTTCCCGAACAGGACCGTGAAAC
AGCATCGCGCCAATGATAGTGAGCTTACCGCTCGCGAAAGTAGGTCAACGCCAGACT
>167879.3:NC_003910_40129_40248 Colwellia psychrerythraea 34H 5S rRNA
TTGTTTAGCGACAATAGCGCTGTGGTCCCACCTGATCCCTTTCCGAACTCAGAAGTGAAA
CGCAGTTGCGCCGATGGTAGTGTGGGAGTTCCCATGTGAGAGTAGGACATTGCTAAACTT
>169963.1:NC_003210_242273_242389 Listeria monocytogenes EGD-e 5S rRNA
GTCTGGTAGTTATGGCGAGAAGGTCACACCCGTTCCCATCCCGAACACGGTAGTTAAGCT
TCTCTGCGCCAATGGTAGTTGGGGGCTTCCCCCTGCGAGAGTAGGTCGCTGCCGGGC
>176280.1:NC_004461_1594564_1594446 Staphylococcus epidermidis ATCC 12228 5S rRNA
GTCTGGTGACAATGGCAAGGAGGTCACACCTGTTCCCATGCCGAACACAGAAGTTAAGCT
CCTTAGCGCCGATGGTAGTCGGACTGACGTTCCGCTAGAGTAGGACGTTGCCAGGCAAA
>177439.1:NC_006138_811337_811458 Desulfotalea psychrophila LSv54 5S rRNA
TTTTCGGTGGCCATAGCGAAGAGGCTCCACCCGTTCCCATTCCGAACACGGAAGTTAAGC
TCTTCAGCGCCGATGGTACTGCATGGGAGACTGTGTGGGAGAGTAGGTCGCCGCCGAATT
TT
>189518.1:NC_004342_184083_184203 Leptospira interrogans serovar Lai str. 56601 5S rRNA
TTCCCGGTGACTATAGAGAGAGGGCCACACCCGTTCCCATCCCGAACACGGAAGTTAAGC
CTCTCATCGCTGATGGTACTATGTGGTTCGCTGCATGGGAGAGTAGGACGTTGCCGGGTT
T
>190304.1:NC_003454_448364_448246 Fusobacterium nucleatum subsp. nucleatum ATCC 25586 5S rRNA
GCTTGGTGAGTATAGCTATGGGGGTACACCTAGTTACATTCCGAACCTAGAAGTTAAGCC
CATATACGCTGATGGTACTTGGCTGGAAGCGGCCTGGGAGAGTATGGATTTGCCAAGCA
>190650.1:NC_002696_2836576_2836455 Caulobacter crescentus CB15 5S rRNA
TGACCTGGTGGCTATGCCGGGGGTTCCCCACCCGATCCCATTCCGAACTCGGTCGTTAAG
TCCCCCTGGGCCAATGGTACTTCGTCTCAAGGCGCGGGAGAGTAGGTCGCCGCCAGGTCC
GC
>192222.1:NC_002163_44741_44860 Campylobacter jejuni subsp. jejuni NCTC 11168 5S rRNA
ATGTCCGTGATTATACAGATGTGGAAACGCCTTGCTCCATCCCGAACCAAGAAGCTAAGC
ACATCGTGGGTGATGATACTACGCCTTACTGGCAGGGGGAAAGTAGCTCATTGCGGACTT
>194439.1:NC_002932_144489_144600 Chlorobium tepidum TLS 5S rRNA
TTACGGCGACTATATCCCTGGTGTTCACCTCTTCCCATTCCGAACAGAGTCGTTAAGCCC
AGGAGAGCCGATGGTACTGCTTTATTGCGGGAGAGTAGGTCGTCGCCGAGTT
>195102.1:NC_003366_14868_14986 Clostridium perfringens str. 13 5S rRNA
TCTGGTGATGATGCTCTTTAGGGTAACACCCGTTTTCCATTCCGAACACGAAGGTTAAGC
CTATTGAGGCCGATGGTACTGCACGGGAGACTGTGTGGGAGAGTAGGTGGTTGCCAGGT
>195102.1:NC_003366_100909_101026 Clostridium perfringens str. 13 5S rRNA
TCTGGTGATGATGTTCTTTAGGGTAACACCCGTTCCCATTCCGAACACGACGGTTAAGCC
TTTAGAAGCCGATGGTACTGCACGGGAGACTGTGTGGGAGAGTAGGTGGTCGCCAGGT
>195102.1:NC_003366_2806531_2806414 Clostridium perfringens str. 13 5S rRNA
TCTAGTGATGATGCGTTTAAGGGTAACACCCGTTCCCATTCCGAACACGACGGTTAAGCC
TTTAACGGTCGATGGTACTGCACGGGAGACTGTGTGGGAGAGTAGATGGTCGCTAGGT
>196164.1:NC_004369_936756_936876 Corynebacterium efficiens YS-314 5S rRNA
TGTGTCGGTGGTGATAGTAGCAGGGAAACGCCCGGTCCCATTCCGAACCCGGAAGCTAAG
CCTGGTTACGCTGATGGTACTGCACTCGGGAGGGTGTGGGAGAGTAGGTGACCGCCGACC
A
>196600.1:NC_005140_310829_310950 Vibrio vulnificus YJ016 5S rRNA
TTGCTTGGCGACCATAGCGTTTTGGACCCACCTGAATCCATTCCGAACTCAGAAGTGAAA
CGAAATAGCGTCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGAACATCGCCAGGCT
TA
>196600.1:NC_005139_2943255_2943134 Vibrio vulnificus YJ016 5S rRNA
TTGCTTAGCGACCATAGCGCTTTGGACCCACCTGATTCCATTCCGAACTCAGAAGTGAAA
CGAAGTAGCGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGACATTGCTAGGCT
CT
>197221.1:NC_004113_2331083_2330964 Thermosynechococcus elongatus BP-1 5S rRNA
TGCCTAGTGCCTATAGCGCGGCGGAACCACGCTGATCCATCCCGAACTCAGAGGTGAAAC
GTCGCAGCGGTGAAGATAGTAGGAGGGTCGCCTCCTGCAAAAATAGCTCGGTGCTAGGCA
>198094.1:NC_003997_14201_14321 Bacillus anthracis str. Ames 5S rRNA
AGTTTGGTGATGATGGCAGAGAGGTCACACCCGTTCCCATACCGAACACGGAAGTTAAGC
TCTCTAGCGCCGATGGTAGTTGGGACCTTGTCCCTGTGAGAGTAGGACGTCGCCAAGCAA
C
>198804.1:NC_004061_540257_540137 Buchnera aphidicola str. Sg (Schizaphis graminum) 5S rRNA
TGCCTGGTAAAAATAGTGTAGTGGTACCACCTGAATCCATTCCGAACTCAGAAGTGAAAC
GCTACAACGCCAATGGTAGTACGGGGTCTCCCCGTGTGAGAGTAGGTATCAGCCAGGCAA
A
>203119.1:NZ_AABG03000017_55701_55581 Clostridium thermocellum ATCC 27405 5S rRNA
ATTCTGGTGGCAATAACGAGAAGGAAACACCCGTTCCCATTCCGAACACGGTAGTTAAGC
TTCTCAGTGCCGATGATACTAGGATGGAGACGTCCTGGGAAAGTAGGTCGCTGCCAGATT
T
>203120.1:NZ_AABH02000008_53009_52893 Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 5S rRNA
TGTCGTGTCGATAGCATAGAGGACACACCTGTTCCCATACCGAACACAGAAGTTAAGCTC
TATAGCGCCGAAAGTAGTTGGAGGATCGCTTCCTGCGAGGATAGGACGATGCGGTGC
>203122.1:NZ_AABI03000002_881751_881632 Microbulbifer degradans 2-40 5S rRNA
TTGCCTGACGACAATAGAGCATTGGAACCACCTGATCCCATCCCGAACTCAGCAGTGAAA
CGATGCATCGCCGATGGTAGTGTGGGGGTTCCCATGTGAGAGTAGGTCATCGTCAGGCTT
>203123.1:NZ_AABJ03000008_6992_6876 Oenococcus oeni PSU-1 5S rRNA
TGTCGTGTTAATTCCGATGAGGCCACACCTGTTCCCATTCCGAACACAGAAGTTAAGCTT
GTCAGGGCCCAAAGTAGTTACAGGAACGCCTGTTGCAAGGTTAGGTCGATGCGATGC
>203124.1:NZ_AABK03000001_1039402_1039522 Trichodesmium erythraeum IMS101 5S rRNA
TTCCTGGTGTCTATGACGCAGTGGAACCACTCCGATCCATCTCGAACTCGGAAGTGAAAC
GCTGCAGTGGTGAAGATACTCGGTGGGTAGCTGCCCGGTAAAATAGCACGATGCCAGGTT
A
>203267.1:NC_004572_218447_218566 Tropheryma whipplei str. Twist 5S rRNA
GTCTCGGGGGCAATGGCAAGAGGGAAACGCCTGGTTACATTCCGAACCCAGAAGCTAAGC
CTCTTAGCGCTGATGGTACTGCAGGGGGGACCCTGTGGGAGAGTAAGACGCCCCCGGGCT
>203907.1:NC_005061_238665_238785 Candidatus Blochmannia floridanus 5S rRNA
AACTTGGTGGCATTAGCGCGATAGTACCACCTGATGACCATTCCGAACTCAGAAGTGAAA
TGTCGTGGTACCGATGGTAGTGTGAGGATTCCTCATGTGAGAGTAGGGGGCTGCCAAGTT
T
>205913.1:NZ_AABM02000003_150365_150246 Bifidobacterium longum DJO10A 5S rRNA
TTTGCGGCGGCCATGGCCCAGGTGAGACGCCCGGTCCCATTCCGAACCCGGAAGCTAAGG
CCTGGCACGGCGATGGTACTGCACCCGACAGGGTGTGGGAGAGTAGCACGCCGCCGCACC
>205914.1:NZ_AABO02000003_130956_130838 Haemophilus somnus 129PT 5S rRNA
AGCTTGGCGGCGATAGTGCGGTGGGACCACCTGACACCATGCCGAACTCAGAAGTGAAAC
GCTGTAACGCCGATGGTAGTGTGGGGATTCCCCATGTGAGAGTAGGGCACCGCCAAGTT
>205914.1:NZ_AABO02000007_12502_12386 Haemophilus somnus 129PT 5S rRNA
TTTTGGCAGTCATAGTGCAATGGAACCACCTAACTCCTTGCCGAACTTAGAAGTGAAACG
TTGTTACGCCGATGGTAGTGTGGGGATTCCCCATGTGAGAGTAGGTCACTGCCAAAT
>205921.3:NC_007432_21204_21321 Streptococcus agalactiae A909 5S rRNA
AGTTAAGTGATAATTGCCTAGGAGATACACCTGTTCTCATGCCGAACACAGAAGTTAAGC
CCTAGAACGCCGGAAGTAGTTGGGGGTTGCCCCCTGTGAGATAAGGTAGTCGCTTAGC
>207559.3:NC_007519_74882_74997 Desulfovibrio desulfuricans G20 5S rRNA
CTTGGTGACCATGGAGGCTGGGGTACACCCGATCCCATTCCGAACTCGGAAGTTAAGCCA
GCCATCGCCGATGATACTGCAAGGGAGCTTGTGGGAAAGTAGGCCGTCGCCAAGGC
>210007.1:NC_004350_21896_22013 Streptococcus mutans UA159 5S rRNA
TGTTAAGTGATGATAGCCTAGGGGAGACACCTGTATCCATGCCGAACACAGCAGTTAAGC
CCTAGCACGCCTGAAGTAGTTGGGGGTTGCCCCCTGTGAGATAGGGTCGTCGCTTAGC
>211586.1:NC_004347_51056_51176 Shewanella oneidensis MR-1 5S rRNA
TTGCTTGGTGACAATAGCATTGTGGTCCCACCTGATCCCATCCCGAACTCAGAAGTGAAA
CGCAATCGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGTCATCGCCAAGCG
C
>212717.1:NC_004557_5447_5331 Clostridium tetani E88 5S rRNA
TCTGGTGATTATAGCTAGAAGGTAACACCCGTTCCCATGCCGAACACGATGGTTAAGCTT
CTAAGCGCCGATGGTACTGCAAGGGTGACCTTGTGGGAGAGTAGGACGTTGCCAGGT
>216432.3:CatlHTCC2559.contigs_4_1261713_1261822 Croceibacter atlanticus HTCC2559 5S rRNA
CGAGGTGGCTGTGGCGGCGGGGCGCACCCCTTCCCATCCCGAACAGGACGGTTAAGCCCG
CCAGCGCCGATGGTACTGCTATCCAGTGGGAGAGTAGGTCGCCGCCTTTC
>216596.1:rhiz582d11.q1n_69432_69552 Rhizobium leguminosarum bv. viciae 3841 5S rRNA
CGACCTGGTGGTTATGGCGGGGTGGCTGCACCCGTTCCCTTTCCGAACACGGCCGTGAAA
CGCCCCTGCGCCCATGGTACTTCGTCTTAAGACGCGGGAGAGTAGGTCGCTGCCAGGTCT
G
>220668.1:NC_004567_507858_507974 Lactobacillus plantarum WCFS1 5S rRNA
TGTGGTGACGATGGCGAGAAGGATACACCTGTTCCCATGTCGAACACAGAAGTTAAGCTT
CTTAGCGCCGAGAGTAGTTGGGGGATCGCTCCCTGCGAGGGTAGGACGTTGCCATGC
>221109.1:NC_004193_108306_108425 Oceanobacillus iheyensis HTE831 5S rRNA
AGTCTGGTAGCGATAGCGAAGAGGCCACACCTGTTCCCATGCCGAACACAGAAGTTAAGC
TCTTCAGCGCCGATGGTAGTTGGGGCTTTGCCCCTGCAAGAGTAGGACGCCGCCAGGCAA
>221109.1:NC_004193_679268_679386 Oceanobacillus iheyensis HTE831 5S rRNA
GTCTGGTAGCGATAGCGAGAAGGTCACACCTGTTCCCATGCCGAACACAGAAGTTAAGCT
TTTCAGCGCCAATGGTAGTTGGGGTTTTACCCCTGCAAGAGTAGGACGCCGCCAGGCAA
>221988.1:NC_006300_3318_3436 Mannheimia succiniciproducens MBEL55E 5S rRNA
ATCCTGGCGGCGATAGTGCAGTGGTCCCACCTGAATCCATGCCGAACTCAGAAGTGAAAC
GCTGTTATGCCGATGGTAGTGTGGGGTATCCCCATGTGAGAGTAGGTCACCGCCAGGTT
>221988.1:NC_006300_407092_407209 Mannheimia succiniciproducens MBEL55E 5S rRNA
TTTTGGCAGCGATAGTGCAGTGGACCCACCTAATTCCATGCCGAACTTAGAAGTGAAACG
CTGTTACGCCGATGGTAGTGTGGGGCTTCCCCATGTGAGAGTAGGTCACTGCCAATTT
>223926.1:NC_004603_2775885_2775763 Vibrio parahaemolyticus RIMD 2210633 5S rRNA
TTACTTGGCGACCATAGCACTTTGGACCCACCTGACTTCCATTCCGAACTCAGAAGTGAA
ACGAAGTAGCGTCGATGGTAGTGTGGGGCTTCCCCATGTGAGAGTAGAACATCGCCAGGT
TCT
>224308.1:NC_000964_14689_14807 Bacillus subtilis subsp. subtilis str. 168 5S rRNA
GTTTGGTGGCGATAGCGAAGAGGTCACACCCGTTCCCATACCGAACACGGAAGTTAAGCT
CTTCAGCGCCGATGGTAGTCGGGGGTTTCCCCCTGTGAGAGTAGGACGCCGCCAAGCAA
>224308.1:NC_000964_950962_951079 Bacillus subtilis subsp. subtilis str. 168 5S rRNA
GTCTGGTGATGATGGCGAAGAGGTCACACCCGTTCCCATGCCGAACACGGAAGTTAAGCT
CTTCAGCGCCGATGGTAGTCGGGGGTTTCCCCCTGTGAGAGTAGGACATCGCCAGGCA
>224324.1:NC_000918_567889_567769 Aquifex aeolicus VF5 5S rRNA
CCCCTGGTGGCCATAGCGGGGGGGAAACACCCGGTCCCATTCCGAACCCGGCAGTTAAGC
CCCCCAGCGCCGATGATACTGTGCCGGCAGCGGCACGGGAAAGTAGGTCGCTGCCAGGGG
C
>224911.1:NC_004463_1533503_1533623 Bradyrhizobium japonicum USDA 110 5S rRNA
CGGCCTGGTGGTTTTAGCGAAGAGCCTCAACCCGATCCCATCCCGAACTCGGCCGTTAAA
CTCTTCAGCGCCAATGGTACTATGGCTTAAGCCCTGGGAGAGTAGGTCGCTGCCAGGCCT
G
>224915.1:NC_004545_508004_507887 Buchnera aphidicola str. Bp (Baizongia pistaciae) 5S rRNA
CCTGGTAAAAATAGTGTTATGGTACCACCTGAAACCATGCCGAACTCAGAAGTGAAACAT
TTCAACGCCGATGGTAGTGCAGGGTATCCCTGTGTGAGAGTAGGACATTACCAGGTTT
>226185.1:NC_004668_253255_253370 Enterococcus faecalis V583 5S rRNA
TGTGGTGGCGATAGCGAGAAGGATACACCTGTTCCCATGCCGAACACAGAAGTTAAGCTT
CTTAGCGCCGATTGTAGTGAAGGGTTTCCCTTTGTGAGAGTAGGACGTCGCCACGC
>226186.1:NC_004663_1626610_1626498 Bacteroides thetaiotaomicron VPI-5482 5S rRNA
TCAGGTGGTTATAGCACGAGGGTTCCACCTCTTCCCATTCCGAACAGAGAAGTTAAGCCT
CGTCACGCCGATGGTACTGCGTAACAGTGGGAGAGTAGGTAGCCGCCGTTTTT
>227377.1:NC_002971_171959_172078 Coxiella burnetii RSA 493 5S rRNA
TTTCCTGGCGGCCATAGCGAGCGGGCCCCACCTGATTCCATTCCGAACTCAGAAGTGAAA
ACGCTTAGCGCCGATGATAGTGTGGGTCTCCCATGCGAAAGTAGGTCACCGCCAGGTTTT
>228399.1:NZ_AACK01000001_104087_103969 Actinobacillus pleuropneumoniae serovar 1 str. 4074 5S rRNA
ATTCTGGCGACCAGAGTGCTGTGGCTCTACCTGACTCCATTCCGAACTCAGAAGTAAAAC
GCAGTAACGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGGCATCGCCAGATT
>228399.1:NZ_AACK01000026_28269_28152 Actinobacillus pleuropneumoniae serovar 1 str. 4074 5S rRNA
TCCCGACGACAATAGTGCGGTTGTCCCACCTGAATCCATCCCGAACTCAGAAGTGAAAAG
CCGTTACGTCGATGGTAGTGTGGGGCTTCCCCATGTGAGAGTAGAGCATCGTCGGGTT
>228410.1:NC_004757_74038_74155 Nitrosomonas europaea ATCC 19718 5S rRNA
TTGCTTGGCGGCCATAGCGCTTTGGACCCACCTTTTCCCATCCCGAACAGAGAAGTGAAA
CGAAGCAGCGCCGATGATAGTGTGTTTCCACATGTGAAAGTAGGTCACCGCCAGGCTT
>233150.3:NC_004829_83491_83598 Mycoplasma gallisepticum R 5S rRNA
TGTGTGATATCGATATCGTGATGGAAACACCTGGTCCCATTCCGAACCCAGAAGTTAAGC
ATCATGGAGCCAAAGGTAGCGCAAGCAAGAATAGGAAAATATCACGCA
>233412.1:NC_002940_15878_15995 Haemophilus ducreyi 35000HP 5S rRNA
ATTCTGGCGACAACAGTGCAGTGGCACCACCTGAATCCATCCCGAACTCAGAAGTGAAAC
GCTGTTACGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGTCATCGCCAGAG
>233412.1:NC_002940_16051_16168 Haemophilus ducreyi 35000HP 5S rRNA
GATTAACAGCAATAGTGCAGTGGTCCCACCTGAATCCATCGCGAACTCAGAAGTGAAACG
CTGTTACGCCGATGGTAGTGTGGGGCTTCCCCATGTGAGAGTAGGACACTGTTAATCT
>234826.3:NC_004842_84032_84150 Anaplasma marginale str. St. Maries 5S rRNA
TGGCTGGTGGTTATGGCGGGAGTGAAACACCCGGTAACATCCCGAACCCGGAAGTTAAGC
CTCCCAGCGCCTGTGGTACTTTGTCTTAAGACACGGGAGAGAGGGTCGCTGCCAGCCTT
>235279.1:NC_004917_953311_953192 Helicobacter hepaticus ATCC 51449 5S rRNA
TTTTTCTTGTGTTTATAGAGAGAAGGCAACACCCAGCTCCATTCCGAACCTGGCAGTTAA
GCTTCTCTTCGCCGATGATACTGCATCTTTCAGGTGTGGGAATGTAGGTCGATGCAGGGA
>235909.3:NC_006510_15702_15824 Geobacillus kaustophilus HTA426 5S rRNA
TTGCCTAGTGGCTATGGCGGAGGGGAAACACCCGTTCCCATCCCGAACACGGAAGTTAAG
CCCTCCAGCGCCGATGGTAGTTGGGGCCAGCGCCCCTGCAAGAGTAGGTCGTTGCTAGGC
GAA
>237727.3:ErythNAP1.contigs_3_1132103_1132222 Erythrobacter sp. NAP1 5S rRNA
TTGCTTGGTGGTCATAGCGTCTGTGACCCACCCGATCCCATCTCGAACTCGGCCGTGAAA
CCAGATAGCGCCGATGGTACTGTGTCTTAAGGCACGGAAGAGTAGGTCGCCGCCAGGCAT
>242619.1:NC_002950_124844_124957 Porphyromonas gingivalis W83 5S rRNA
TTCAGGTGGTTATAACGTTGGGGATCCACCTCTTCCCATTCCGAACAGAGAAGTTAAGCC
CAACGGTGCCGATGGTACTGCGTCACAGTGGGAGAGTAGGACGCCGCCGTTTTT
>243090.1:NC_005027_4611312_4611202 Pirellula sp. 1 5S rRNA
TTCCGGCGATCATATCTTAAAGGTTATACCTGTTCCCATTCCGAACACAGCAGTCAAGCT
TTAAGAGCCGATGATAGTGCCCACCAGCGTGAAAGTAGGTCTTGCCGGATT
>243161.4:NC_002620_138687_138805 Chlamydia muridarum Nigg 5S rRNA
TTAGCTTGGTGATAATAGAGAGAGGGAAACACCTGATACCATTCCGAACTCAGAAGTTAA
GCCTCTGATCGCTGATGGTACTATACACAAGAGTATGGGAGAGTAGGTCGTTGCCAAGC
>243164.3:NC_002936_50767_50889 Dehalococcoides ethenogenes 195 5S rRNA
TCCCCCGGTGGTTAGAGCGGGGTGGTACCACCCGTTCCCGTCCCGAACACGGTCGTGAAA
CGCCCCAGCGCAGACGATACTTAGGAGGCAACTCCTTGTGGAAAATATGCCACTGCCCGG
GGA
>243230.1:NC_001263_254394_254514 Deinococcus radiodurans R1 5S rRNA
ACCCCCGTGCCCATAGCACTGTGGAACCACCCCACCCCATGCCGAACTGGGTCGTGAAAC
ACAGCAGCGCCAATGATACTCGGACCGCAGGGTCCCGGAAAAGTCGGTCAGCGCGGGGGT
T
>243231.1:NC_002939_689761_689881 Geobacter sulfurreducens PCA 5S rRNA
TTCTCGGTGGCTATGCCGAGGGGGTCACACCCGTTCCCATCTCGAACACGGAAGTTAAGC
CCCTCTGGGCCGATGATACTGCACGGGCAGCTGTGTGGGAAAGTAGGTCGCCGCCGGGAT
T
>243233.4:NC_002977_793177_793294 Methylococcus capsulatus str. Bath 5S rRNA
TGCCTGGCGGCCAGAGCGAGCGGGAACCACCCGATCCCATCCCGACCTCGGAAGTGAAAC
CGCTTAGCGCCGATGATAGTGCAGAATACCTGTGCGAAAGTAGGGAACTGCCAGGCTC
>243273.1:NC_000908_174685_174796 Mycoplasma genitalium G-37 5S rRNA
TGTTTGGTGCTAATATCGCTGTGGAAACACCTGGAACCATCCCGAACCCAGCAGTTAAGC
ACAGTGGAGCTAAATGTAGGTAGTAATACTGAGAATAGGTAAGCACCAAGCA
>243274.1:NC_000853_193827_193948 Thermotoga maritima MSB8 5S rRNA
CCCCGGGTGCCGATACTGGGGCGGGAAACACCCGGTTCCATTCCGAACCCGGCCGTTAAG
CCGCCCTGGGCCGATGGTAGTATGGGGGCAGCCCCATGCGAGAGTAGGTAGCGCCCGGGG
AT
>243275.1:NC_002967_615207_615319 Treponema denticola ATCC 35405 5S rRNA
CCAGGTGGCCATAGTGGAGAGGTAATACCCGTTCCCATCCCGAACACGGAAGTCAAGCTC
TCTTACGCCGATGATACTGCTGATCAAGTGGGAAAGTAGGATGCTGCCTGGCT
>243276.1:NC_000919_234945_235056 Treponema pallidum subsp. pallidum str. Nichols 5S rRNA
CCTGGTTGCCATGGTGGAGAGGTCATACCCGTTCCCATCCCGAACACGGAAGTCAAGCTC
TCCTACGCCGATGATACTGCTCCTTCGCGGGAAAGTAGGTAGTAGCCAGGCT
>243365.1:NC_005085_426447_426566 Chromobacterium violaceum ATCC 12472 5S rRNA
ATGTCTGGTGGCCATAGCGAGGTGGTCCCACGCCTTCCCATCCCGAACAGGACCGTGAAA
CGCCTTAGCGCCGATGATAGTGTGGCATTCGCCATGTGAAAGTAGGACACCGCCAGACGC
>243365.1:NC_005085_1652252_1652371 Chromobacterium violaceum ATCC 12472 5S rRNA
TTTTCTGGCGACCATAGCGAGATGGCCCCACGCCTTCCCATTCCGAACAGGACCGTGAAA
CATCTTAGCGCCGATGATAGTGTGGCATTCGCCATGTGAAAGTAGGACATCGCCAGATCT
>246194.3:NC_007503_1392791_1392672 Carboxydothermus hydrogenoformans Z-2901 5S rRNA
TTTCCGGTGGCCATAGCGGAGGGGAAACACCCGTTCCCATTCCGAACACGGCAGTTAAGC
CCTCCAGCGCCAATGGTACTGGGACGATAGGTCCCGGGAGAGTAGGTCGCTGCCGGAAAA
>246200.3:NC_003911_267353_267471 Silicibacter pomeroyi DSS-3 5S rRNA
GGTTTGGTGGTCATAGCGAGCGCAATACACCCGGTCCCTTCCCGAACCCGGAAGTTAAGT
GCCTCCGCGCCAATGGTACTCGGGCTCAAGCCCCGGGAGAGTAGGTCACCGCCAAACCT
>247156.1:NC_006361_1184663_1184782 Nocardia farcinica IFM 10152 5S rRNA
GTTACGGCGGTCATAGCGGTGGGGAAACGCCCGGTCCCATTCCGAACCCGGAAGCTAAGC
CTGCCAGCGCCGATGGTACTGCACTCGACAGGGTGTGGGAGAGTAGGACACCGCCGGAAC
>251221.1:NC_005125_1567916_1567798 Gloeobacter violaceus PCC 7421 5S rRNA
TTCCTGGTGCTCAGGCGCAGTGGAACCACGCCGATCCATCCCGAACTCGGACGTTAAACG
CTGCAGCAGCGAAGATACTTGGAGGGCAGCTTCCTGGGAAAATAGCCCGGTGCCAGGGA
>252305.3:ObatHTCC2597.contigs_13_173645_173764 Oceanicola batsensis HTCC2597 5S rRNA
TGGTCTGGTGGTCATAGCACAAGCGAAACACCCGATCCCATCCCGAACTCGGCCGTTAAG
CGCTGTCGCGCCAATGGTACTGCGTCTCAAGACGTGGGAGAGTAGGTCACCGCCAGACCT
>254945.3:NC_005295_1283687_1283570 Ehrlichia ruminantium str. Welgevonden 5S rRNA
GGGTTGGTGGTAATAGCAGAAGTGATACACCCAGCTACATTTCGAACCTGGAAGTTAAGC
CTTCTAGCGCTTATGGTACTTTGTCTTAAGGCACGGGAGAGTAGGTCGCTGCCACCCT
>257309.1:NC_002935_748458_748578 Corynebacterium diphtheriae NCTC 13129 5S rRNA
TGTGTTGGTGGTTATTGTGTCGGGGGTACGCCCGGTCCCTTTCCGAACCCGGAAGCTAAG
CCCGATTGCGCTGATGGTACTGCACCTGGGAGGGTGTGGGAGAGTAGGTCGCCGCCAACC
T
>257310.1:NC_002927_1978102_1978216 Bordetella bronchiseptica RB50 5S rRNA
GCCTGACGACCATAGCAAGGTGGTCCCACTCCTTCCCATCCCGAACAGGACAGTGAAACG
CCTTCGCGCCGATGATAGTGGATGTACATCTGTGAAAGTAGGTCATCGTCAGGCT
>258594.1:NC_005296_4992515_4992395 Rhodopseudomonas palustris CGA009 5S rRNA
CGGCCTGGTGGTTCTAGCGAGGAGCCTGAACCCGTTCCCATCCCGAACACGGCCGTTAAA
CTCCTCAGCGCCAATGGTACTCCGTCTCAAGACGCGGGAGAGTAGGTCGCCGCCAGGCCT
G
>259536.3:NC_007204_665719_665836 Psychrobacter sp. 273-4 5S rRNA
TTTGCTGACGACAATAGCACGATGGCCCCACCTGATCCCTTACCGAACTCAGAAGTGAAA
CATCGTCGCGCCAATGGTAGTGTGGTTCGCCCATGTGAGAGTAGGTCATCGTCAGCTC
>262723.3:NC_007294_647636_647530 Mycoplasma synoviae 53 5S rRNA
CAATAGTGGCCATAGCGAAGGTTTGCACCTGATACCATTCCGAACTCAGTAGTTAAGCCC
TTTAGCGCCTAAGATAGCTGAAAAGCAAAAATCGGGAGCTGCTTTTT
>262724.1:NC_005835_1537462_1537582 Thermus thermophilus HB27 5S rRNA
TCCCCCGTGCCCATAGCGGCGTGGAACCACCCGTTCCCATTCCGAACACGGAAGTGAAAC
GCGCCAGCGCCGATGGTACTGGGCGGGCGACCGCCTGGGAGAGTAGGTCGGTGCGGGGGA
T
>264198.3:NC_007347_1894082_1893966 Ralstonia eutropha JMP134 5S rRNA
ATGCCTGGTGACCATAGCGAGCTGGAACCACCCCTTCCCATCCCGAACAGGTCCGTGAAA
CAGCTCCGCGCCGATGATAGTGCGGATACCCGTGTGAAAGTAGGTCATCGCCAGGCT
>264201.1:NC_005861_1227394_1227275 Parachlamydia sp. UWE25 5S rRNA
TTCGTTTGGTGGCATTAGAGAAAGGGAAATACCTGAACCCATTCCGAACTCAGAAGTCAA
GCCTTTCATCGCCGATGGTACTGCACACAAGAGTGTGGGAGAGTAGGTCGCCGCCAAACT
>264203.3:NC_006526_1613059_1612939 Zymomonas mobilis subsp. mobilis ZM4 5S rRNA
TAGCTTGGTGGCTATAGCGTCAGTGACCCACCCGATCCCATTTCGAACTCGGACGTGAAA
CCTGTCCTGCGCCGATGGTACTGTTGCTTAAGCAACGGAAGAGTAGGTCGTCGCCAGGCT
T
>264462.1:NC_005363_824615_824735 Bdellovibrio bacteriovorus HD100 5S rRNA
TTTGCTGGTGTTTATAGCAGAGGGGCCACACCTGATCCCATTCCGAACTCAGAAGTTAAG
TCCTCTTGCGGCGATGGTATTGCATTGGTGACAATGTGGGAGAGTAGCACGACGCCAGCT
C
>264732.1:NZ_AADT02000007_5365_5483 Moorella thermoacetica ATCC 39073 5S rRNA
TTTCTGGTGGTAATAGCGGAGGGGAAACACCCGTTCCCATCCCGAACACGGCAGTTAAGC
CCTCCAGCGCCGATGGTACTGGGGAGTATTCCCCGGGAGAGTAGGACACCGCCAGGAAA
>265072.1:NZ_AADX01000005_167301_167183 Methylobacillus flagellatus KT 5S rRNA
ATGTCTGGCGGCCATAGCGAATTGGAACCACCCCTTCCCATCTCGAACAGGGCCGTGAAA
CGATTCCGCGCCAATGATAGTATGCACTACGCATGCGAAAGTAGGTCACCGCCAGGCTT
>265311.3:NC_006055_196560_196668 Mesoplasma florum L1 5S rRNA
ATCTGGTGGTCATAGCGTAGAGGTCACACCTGTTCCCATACCGAACACAGAAGTTAAGCT
CTACAGCGTCGACGATATTGCATTGTGAGAAAATAGAACGCTGCCAGTT
>266117.1:NZ_AAEB01000008_29174_29058 Rubrobacter xylanophilus DSM 9941 5S rRNA
AAGGGTGACGATAGCGGCGGGGATACACCTCTTCCCATTCCGAACAGAGAAGTTAAGCCC
GCCAGCGCCGATGGTACTGCGGGGGGGACCCCGTGGGAGAGTAGGTCGTCGCCCATT
>266940.1:NZ_AAEF01000001_19251_19371 Kineococcus radiotolerans SRS30216 5S rRNA
GTCCGGTGGTCATAGCGGTGGGGAAACGCCCGGTCTCATTCCGAACCCGGAAGCTAAGCC
CACCAGCGCCGATGGTACTGCTCGGGAGACTGGGTGGGAGAGTAGGTCACCGCCGGCCAC
T
>267608.1:NC_003295_1537733_1537847 Ralstonia solanacearum GMI1000 5S rRNA
GCCTGGTGACCATAGCGAGTCGGTACCACCCCTTCCCATCCCGAACAGGACCGTGAAACG
ACTCCGCGCCGATGATAGTGCGGATTCCCGTGTGAAAGTAGGTCATCGCCAGGCT
>267747.1:NC_006085_611077_611198 Propionibacterium acnes KPA171202 5S rRNA
TTTCCGGTGGCCATAGTGGAAGGGAAACACCCGGTCCCATTCCGAACCCGGTCGTTAAGC
CTTCCAACGCTGATGGTACTGCACGAGGGATCGTGTGGGAGAGTAAGACGCTGCCGGAAT
AC
>267748.1:NC_006908_260702_260596 Mycoplasma mobile 163K 5S rRNA
AACAAGCAACTATAGCAAGAGTGTACACCTGAACCCATTCCGAACTCAGTAGTTAAGCCT
CTTAGCGTCGAAGATACCAGTAATGGGAAAATAGAGCGTTGCTTTTT
>269484.4:NC_007354_1098918_1098799 Ehrlichia canis str. Jake 5S rRNA
GGGTTGGTGGTAATAGCGGAAGTGGTACACCCAGCTTACATTTCGAACCTGGAAGTTAAG
CCTTCTAGCGCTGATGGTACTTTGTCTTAAGGCACGGGAGAGTAAGTCACTGCCACCCTT
>269800.4:NC_007333_2386932_2386813 Thermobifida fusca YX 5S rRNA
GTTACGGCGGTCATAGCGGGCGGGGTCCACCCGGTCCCATTCCGAACCCGGTCGTTAAGC
CGCCCAGCGCCGATGGTACTGCCCTGTGGTGGGGTGGGAGAGTAGGACACCGCCGTACAC
>272558.1:NC_002570_123272_123388 Bacillus halodurans C-125 5S rRNA
GTTTGGTGGCGATAGCGAAGAGGCCACACCCGTTCCCATGCCGAACACGGTCGTTAAGCT
CTTCAGCGCCGATGGTAGTTGGGGGCTTCCCCCTGCGAGAGTAGGACGCTGCCAAAC
>272562.1:NC_003030_14377_14494 Clostridium acetobutylicum ATCC 824 5S rRNA
TCCGGTGACCATAGCTTGGTTGTAACACCCGTTCCCATACCGAACACGAAGGTTAAGAAC
CAAAGCGCCGATGGTACTGCAGGGGCAGCCCTGTGGGAGAGTAGGTCATTGCCGGGTA
>272562.1:NC_003030_168142_168260 Clostridium acetobutylicum ATCC 824 5S rRNA
TCCGGTGATCATAGCTTGGTTGTAACACCAGTTCCCATACCGAACACGAAGGTTAAGAAC
CAAAGCGCCGATGCGTACTGCAGGGGCAACCGTGTGTCAAATGAGGTCATTGCCGGGTA
>272621.3:NC_006814_63997_64113 Lactobacillus acidophilus NCFM 5S rRNA
TACGGTGGCGAAAGCAAGAAGGATACACCTGTTCCCATGCCGAACACAGAAGTTAAGCTT
CTTAACGCCGAAAGTAGTTGGTGGGCAACTGCCTGCGAGGATAGGAAGCTGCCGTGC
>272623.1:NC_002662_28694_28812 Lactococcus lactis subsp. lactis Il1403 5S rRNA
TATTTGGTATTTATTGCATAGGAGATATACCTGTTCCCATGTCGAACACAGAAGTCAAGT
CCTTTTGCGCTGGAAGTACTTGGGGGTTGCCCCCTGGGAGATAAAGACGATGCCAAGTT
>272623.1:NC_002662_542396_542512 Lactococcus lactis subsp. lactis Il1403 5S rRNA
ATTTGGTCATCATTGCGATGGAGATACACCTGTTCCCATGTCGAACACAGAAGTTAAGTC
CATCTACGGCGGAAGTACTTGGGGGTTGCCCCCTGGGAGATAGGCGAGTGGCCAAGT
>272624.3:NC_002942_364721_364842 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 5S rRNA
TTTCCTGGCGACTATAGCGATTTGGAACCACCTGATACCATCTCGAACTCAGAAGTGAAA
CATTTCCGCGCCAATGATAGTGTGAGGCTTCCTCATGCGAAAGTAGGTCATCGCCAGGGT
TT
>272632.1:NC_005364_83700_83591 Mycoplasma mycoides subsp. mycoides SC str. PG1 5S rRNA
ATCTGGTGGTTATAGCATAGAGGTCACACCTGTTCCCATGCCGAACACAGAAGTTAAGCT
CTATTACGGTGAAAATATTACTTATGTGAGAAGATAGCAAGCTGCCAGTT
>272633.1:NC_004432_1233295_1233188 Mycoplasma penetrans HF-2 5S rRNA
AATGCAGTGTTAATATTGTAGTGGAAACACCTGTTCCCATCCCGAACACAGAAGTTAAGC
ACTATGAAGCCAAAGGTAGCTTTTGCAAGAATAGGAAGATGCTGCTTA
>272634.1:NC_000912_122997_123107 Mycoplasma pneumoniae M129 5S rRNA
TGTTTGGTGCCCATGTCGCTGTGGAAACACCTGGTTCCATTTCGAACCCAGCAGTTAAGC
ACAGTGGAGCCGAATGTAGCTGTTTCAGTGAGAATAGGAAAGCACCAAGCG
>272635.1:NC_002771_260265_260369 Mycoplasma pulmonis UAB CTIP 5S rRNA
AACAAGTGACCATAACGCAAGTTATACCTGATACCATTCCGAACTCAGTAGTCAAGACTT
GTGGTGCCGACGATACCCGCTGGGGAAAATAGGGAGTTGCTTTTT
>272843.1:NC_002663_1937607_1937491 Pasteurella multocida subsp. multocida str. Pm70 5S rRNA
TTTTGGTAGCCATAGTGCAGCAGACCCACCTGAACCCATGCCGAACTCAGAAGTGAAATG
TTGTAACGCCGATGGTAGTGTGGGGTTTCCCCATGTGAGAGTAGGTCACTACCAAAT
>272943.3:NC_007493_5110_5228 Rhodobacter sphaeroides 2.4.1 5S rRNA
GGTCTGGTGGCCATAGCACGAGCAAAACACCCGATCCCATCCCGAACTCGGCAGTTAAGT
GCCGTCGCGCCAATGGTACTGCGTCTCAAGACGTGGGAGAGTAGGTCGCCGCCAGACCT
>273119.1:NC_002162_150121_150227 Ureaplasma parvum serovar 3 ATCC 700970 5S rRNA
TGTGTAGTGATTATATCAGAGTGGAAATACCTGTTCCCATCCCGAACACAGAAGTCAAGC
ACTCTAGAGCCGAAAATAGCGCAAGTAAAATAGGTCATCGCTACGCT
>273121.1:NC_005090_141246_141368 Wolinella succinogenes DSM 1740 5S rRNA
TTTTTCTCGTGCCTATAGAGGAGAGGCTACACCCAGCTCCATTCCGAACCTGGCAGTTAA
GCTCTCCATCGCCGATAATACTGCATCTTTCAGGTGTGGAAACGTAGGTTGGTGCGGGGA
GGG
>283165.1:NC_005955_1173229_1173109 Bartonella quintana str. Toulouse 5S rRNA
TGACTTGGTGGTTATGGCGGAGCGAACGCACCCGATCCCATCCCGAACTCGGCCGTGAAA
CGTTCCAGCGCTGATGGTACTTTGCCTTAAGGCACGGGAGAGTAAGTCGCTGCCAGGTCT
G
>283942.3:NC_006512_1263018_1262897 Idiomarina loihiensis L2TR 5S rRNA
ATGTCTGGCGGCCATAGCGGTGTGGCACCACCTGAATCCATTCCGAACTCAGAAGTGAAA
CACACCAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGTCACCGCCAGACT
TT
>290633.1:NC_006677_238471_238352 Gluconobacter oxydans 621H 5S rRNA
AAGACTGGTGGCCATTGCGAGGGCCCTACACCCGATCCCATCCCGAACTCGGCCGTGAAA
TCCCTCAGCGCCTATGATACTGCACCTTAAGGTGCGGAAAAGTCGGTCGCCGCCAGGTCC
>291272.3:NC_007292_260445_260564 Candidatus Blochmannia pennsylvanicus str. BPEN 5S rRNA
TACTTGGTGGCATTAGCGCGATAGTACCACCTGATTCCATTTCGAACTCAGAAGTGAAAT
GTCGTAGTACCGATGGTAGTGTGGGGTGTCCTCATGCGAGAGTAGGGGGCTGCCAAGTAT
>292414.1:Contig49_319_436 Silicibacter sp. TM1040 5S rRNA
GGTTTGGTGGCCAAAGCACAAGCGAAACACCCGGTCCCTTCCCGAACCCGGAAGTTAAGC
GCTGTTGCGCCGATGGTACTGCATCTTAAGGTGTGGGAGAGTAGGGCACCGCCAAACC
>292415.3:NC_007404_483458_483574 Thiobacillus denitrificans ATCC 25259 5S rRNA
TGTCTGACGACCATAGCAGAGTGGAACCACCCCTTCCCATCCCGAACAGGACGGTGAAAC
GCTCCCGCGCCAATGATAGTAGGCATTCGCCTGTGAAAGTAGGTCATCGTCAGACTC
>296591.1:3634502_Cont45_275013_274897 Polaromonas sp. JS666 5S rRNA
ATGCCTGATGACCATAGCAAGTTGGTACCACTCCTTCCCATCCCGAACAGGACAGTGAAA
CGACTTAGCGCCGATGATAGTGCGGATTCCCGTGTGAAAGTAGGACATCGTCAGGCT
>298386.1:NC_006370_74714_74834 Photobacterium profundum SS9 5S rRNA
TTGTCTGGCGACCATAGCGCTGTGGCTCCACCTGATCCCATGCCGAACTCAGAAGTGAAA
CGCAGTTGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGGCATCGCCAGGCC
C
>298386.1:NC_006370_785386_785506 Photobacterium profundum SS9 5S rRNA
TTACTTGGCGACAATAGCACTATAGAACCACCTGATCCCATGCCGAACTCAGAAGTGAAA
TATAGTTGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGTCATTGCCAAGTT
C
>306537.3:NC_007164_113847_113968 Corynebacterium jeikeium K411 5S rRNA
TTTGTCGGTGGTTGTTAGCGGTGGGGTCACGCCCGGTCCCTTTCCGAACCCGGAAGCTAA
GCCTACCTGCGCTGATGGTACTGCACCTGGGAGGGTGTGGGAGAGTAAGTCACCGCCGGC
AC
>313589.3:JaniHTCC2649.contigs_7_728_849 Janibacter sp. HTCC2649 5S rRNA
GTTTCGGCTGTCATAGCGAAGGGGAAACGCCCAGCTCCATTCCGAACCTGGAAGCTAAGC
CCTTCAGCGCCGATGGTACTGCACTGGTGACGGTGTGGGAGAGTAGGACGCAGCCGGACA
AT
>313590.3:CellMED134.contigs_1_232641_232750 Cellulophaga sp. MED134 5S rRNA
TAAGGTGGTTATAGCGACGGGGCTCACCTCTTCCCATTCCGAACAGAGAAGTTAAGCCCG
CCAGCGCCGATGGTACTGCACTCGTGGGAGAGTAGGTCGCCGCCTTTTTA
>313593.3:FlavoMED217.contigs_12_9509_9399 Flavobacterium sp. MED217 5S rRNA
TAAGGTGGTTATAGCGACGGGGCTCACCTCTTACCATTCCGAACAGAGTAGTTAAGCCCG
TTAGCGCCGATGGTACTACATCTCGTGGGAGAGTAGGTCGCCGCCTTGTTT
>313598.3:TenaciMED152.contigs_1_5579_5690 Tenacibaculum sp. MED152 5S rRNA
TAGGGTGGTTATAGCATTGGGGCTCACCTCTTCCCATACCGAACAGAGAAGTTAAGCCCA
ATAGCGCCGATGGTACTGCATTTATGTGGGAGAGTAGGTCGCTGCCTTTCTT
>314225.3:ElitHTCC2594.contigs_8_796756_796637 Erythrobacter litoralis HTCC2594 5S rRNA
TTGCTTCGTGGTCCTAGCGCCTGTGACCCACCCGATCCCATCTCGAACTCGGCCGTGAAA
CCAGGCAGCGCCGATGGTACTAGTGCTCAAGCACTGGAAGAGTAGGTCACCGCGAGGCAT
>314232.3:LvestSKA53.fas_1_156_275 Loktanella vestfoldensis SKA53 5S rRNA
TGGTTTGGTGGTCATAGCGCGAGCAAAACACCCGATCCCATCCCGAACTCGGCAGTTAAG
TGCCGCAGCGCTGATGGTACTGCGTCTTAAGACGTGGGAGAGTAAGTCACTGCCAAACCT
>314254.3:OalexHTCC2633.contigs_14_277_398 Oceanicaulis alexandrii HTCC2633 5S rRNA
CGACCGGGTGGTTATAGCGAAGGCTCCACACCCGTTCCCATCCCGAACACGGCCGTTAAG
ACCTTCTGCGCCAATGGTACTATGTCCTAAGGCATGGGAGAGTAGGTCGCCGCCCGGTCC
GC
>314260.3:PbermHTCC2503.contigs_4_403049_402929 Parvularcula bermudensis HTCC2503 5S rRNA
CGGCCCGGTGATTATTGCGCGGGGCCCCCACCTGATCCCATCTCGAACTCAGCCGTTAAA
TCCCGCAGCGCCGATGGTACTTCGTCTCAAGGCGTGGGAGAGTAGGTCGTCGCCGGGCCT
G
>314262.3:RoseMED193.contigs_11_191757_191638 Roseobacter sp. MED193 5S rRNA
TGGTTTGGTGGCGATAGCGAGAGCAAAACACCCGGTCCCATCCCGAACCCGGAAGTTAAG
TGCCTTTGCGCCAATGGTACTGCGGCTTAAGTCGTGGGAGAGTAGGTCACTGCCAAACCT
>314271.3:RhodoHTCC2633.contigs_31_33810_33929 Rhodobacterales bacterium HTCC2654 5S rRNA
TGGTGTGGTGGTCATAGCGCGAGCAAAACACCCGGCTCCATCCCGAACCCGGCCGTTAAG
TGCCGTAGCGCCGATGGTACTGCGTCTTAAGACGTGGGAGAGTAGGTCACCGCCACACCT
>314276.3:IbalOS145.contigs_13_3968_3848 Idiomarina baltica OS145 5S rRNA
ATGTCTGGCGGCCATAGCGGTATGGCACCACCTGGCTCCATTCCGAACCCAGAAGTGAAA
CATACCAGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGACACCGCCAGACT
T
>314315.3:NC_007576_310982_311098 Lactobacillus sakei subsp. sakei 23K 5S rRNA
TGTGGTGGCGATAGCAAGAAGGATACACCTGTTCCCATGTCGAACACAGTAGTTAAGCTT
CTTAGCGCCGATAGTAGTTGGTGGGAAACTACCTGCGAGGATAGGACGTTGCCACGC
>318161.3:NZ_AAIU01000061_12329_12209 Shewanella denitrificans OS-217 5S rRNA
TTGTCTGGAAACCATAGAGCTGTGGCACCACCTGATCCCATTCCGAACTCAGAAGTGAAA
CACAGTATCGCCGATTGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGTCATTTCCAGGCG
C
>319225.3:NC_007512_112720_112831 Pelodictyon luteolum DSM 273 5S rRNA
TTACGGCGACTATTTCCCAGGTGATCACCTCTTCCCATTCCGAACAGAGTAGTTAAGCCC
TGGAGAGCCGATGGTACTGCTTTACTGCGGGAGAGTAGGTCGTCGCCGAGTT
>323261.3:NC_007484_1004555_1004674 Nitrosococcus oceani ATCC 19707 5S rRNA
TTGCCTGGTGGCCATAGCGAGTAGGCCCCACCCGATCCCATTCCGAACTCGGAAGTGAAA
CTGCTCAGCGCCGATGATAGTGTGGGGTTACCCATGTGAAAGTAGGTCACTGCCAGGCGC
>323850.3:Contig152_174673_174553 Shewanella sp. PV-4 5S rRNA
TTGTCTGGAAACCATAGCATTGTGGTCCCACCTGATCCCATCCCGAACTCAGAAGTGAAA
CGCAATCGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGTCATTTCCAGGCG
C
>326297.3:NZ_AAIN01000060_5571_5451 Shewanella amazonensis SB2B 5S rRNA
TTGCTTGGTGACAATAGCGCTCTGGTCCCACCTGATCCCATTCCGAACTCAGCAGTGAAA
CGGAGCAGCGCCGATGGTAGTGTGGGGTCTCCCCATGTGAGAGTAGGTCATTGCCAAGCG
C
>326297.3:NZ_AAIN01000004_294320_294199 Shewanella amazonensis SB2B 5S rRNA
TTGCTTGGAAACCATAGCGCTGTGGTCCCACCTGATCCCATTCCGAACTCAGTAGTGAAA
CGCAGTAGCGCCGATGGTAGTGTGGGGCCTCCCCATGTGAGAGTAGGACATTTCCAGGCT
TC
>326298.3:NC_007575_458176_458295 Thiomicrospira denitrificans ATCC 33889 5S rRNA
TTGTCTAGGTGGCTATAGAGAGAGGGAAACGCCTGGTCCCATTCCGAACCCAGAAGCTAA
GCCTCTCATCGCTGATAATACTGATCCTTGCAGGATTGGAAATGTAGGTCGCTGCCTAGT
>326442.4:NC_007481_40346_40466 Pseudoalteromonas haloplanktis TAC125 5S rRNA
TTGCTTGGTAACAATAGCGTTTTGGACCCACCTGACCCCATGCCGAACTCAGTAGTGAAA
CGAAACAGCGCCGATGATAGTGTAGCATTTGCTATGTGAAAGTAGGACATTGCCAGGCTC
C
>335992.3:NC_007205_564530_564648 Candidatus Pelagibacter ubique HTCC1062 5S rRNA
TCGCCGGTGATTATTGCGAAGGGGTTATACCCGATCCCATTCCGAACTCGGAAGTCAAGC
CCTTCAGCGCCAATGGTACTTTGTCTTAAGACACGGAAGAGTAGGACATTGCCGGCTAT
>97084.1:vorax50d06.q1k_799_918 Bacteriovorax marinus SJ 5S rRNA
TTTGGGTGTGTCGATAGCGACGAGGAAATACCTGATCCCATCCCGAACTCAGAAGTCAAG
CTCGTCAGCGGCGAAAGTAGTGCCAGGGGGACTTGGTGTGAGGCTAGCACGATGCACCCA
>224326.1:NC_001318_435312_435201 Borrelia burgdorferi B31 5S rRNA
CCCTGGTGGTTAAAGAAAAGAGGAAACACCTGTTATCATTCCGAACACAGAAGTTAAGCT
CTTATTCGCTGATGGTACTGCGAGTTCGCGGGAGAGTAGGTTATTGCCAGGG
>262719.3:NC_007295_783291_783397 Mycoplasma hyopneumoniae J 5S rRNA
TAAGAGTAACAATAGCAAAAGGGATCACCTGAATCCATTCCGAACTCAGTAGTTAAGCCT
TTTTACGCCGAAGATACTAGAAATAGGAAAATAGGGAGTTACTCTTT
>292459.1:NC_006177_25927_26036 Symbiobacterium thermophilum IAM 14863 5S rRNA
TTGGGTGGCGATGCCGGAGGGGATCACCCGTTCCCATTCCGAACACGGAAGTTAAGCCCT
CCAGGGCCGAAGGTACTCCGCAAGGGGGAGAATAGGTCGCTGCCCAAACT
>955.1:culex74f02.p1k_10677_10566 37716 bp, 485 reads, 66.21 AT
TGACTTGGTGGCTATAGCAAAAATGAACCACCCGATCTCATTTCGAACTCGGAAGTGAAA
CTTTTTAGCGCCGATGATACTTAAAAAGGGAAAGTAGGTCGTTGCCAAGTTT
>163164.1:NC_002978_185257_185368
TGACTTGGTGGCTATAGCAAAAATGAACCACCCGATCTCATCTCGAACTCGGAAGTGAAA
CTTTTTAGCGCTGATGGTACTTGAAAAGGGAGAGTAGGTCGCCGCCAAGTTT
>292805.3:NC_006833_899485_899374
TAACTTGGTGGTTTTAGCAAAAATGAAACACCCGATCCCATCTCGAATTCGGAAGTGAAA
CTTTTTAGCGCTGATGGTACTTGAAAAGGGAGAGTAGGTCGCTGCCAAGTTT
>262768.1:NC_005303_560382_560268
ATCCTTGGTGCATAAAACTAAGGGGCAACACCTGTTCCCATCCCGAACACAGCAGTTAAG
TCCTTAGTACTGACAATAGTTCTTTATTGAGCGAAGATAGGGAGTGCCAAGGTTT
>273035.1:spiro.fasta.screen.Contig78_7105_6993
TAATCTGGTGCTTATGGCATAGTGGACACACCCGTTCCCATCCCGAACACGGAAGTTAAG
CACTATTACGCCGATGATAGCCGCAAGGTGAAAATAGGTCAGTGCCAGGTTAA

MCS Webmaster
ViewVC Help
Powered by ViewVC 1.0.3